Pope's astronomer dismisses ID and says Church was "spectacularly wrong" in its treatment of Galileo

[Betterave]

Because we have never found any aluminium objects, even very simple ones, associated with other Palaeolithic remains. Because we have never found any signs of Palaeolithic man mining for aluminium ores, as we have found of them mining for flint. Because we have never found any sign of aluminium smelters dating from that period. Because we know that until the late 19th century aluminium was a rare and precious metal; you can find aluminium jewellery in antique shops sometimes and we have never found such jewellery in palaeolithic deposits.

Unfortunately you answered a rhetorical question here and missed the point. None of the points here point to an independent assessment of paleolithic man himself. Each of these bits of evidence is based on our ability to immediately recognize the artifacts of intelligent beings. All subsequent construction of knowledge is based on this primary source of data, isn’t it?

Those claims were not claims about ID but claims about evolution. The original claim was “Evolution cannot produce Irreducible Complexity”. That is a falsifiable claim about evolution which was duly falsified. It was not a claim about ID.

Oh? Can you please explain this? I thought that “Evolution cannot produce Irreducible Complexity” was true by definition. How was this claim falsified?

I shall go back to my Christian analogy. Arians reject the Divinity of Christ, but accept most of the rest. Nestorians reject the humanity of Christ but accept much of the rest. The Marcionites rejected all of the Old Testament and big chunks of the new. The MCC rejects the restriction of marriage to heterosexual couples. Many churches reject the traditional restriction of male only vicars. All of these are rejecting part of the general consensus of Christianity.

ID is like a new sect which rejects all of the individual things that each of those other sects reject: Christ is neither divine nor human. Much of the Bible is ignored. Gay marriage is allowed as are women priests and bishops. Would that new sect be Christian? Yet it could point to a different sect of Christianity to justify each of its rejections of the consensus.

ID has rejected too much of the consensus of science to be considered science.

Again, that is obviously all vague assertion. It might be true, but then again it might not. Either way, you’ve completely avoided any concrete analysis that would contribute to our knowing which is the case.

One helpful point that can be brought out by your analogy is that what counts as ‘science’ is not something that can be decided by any clear cut criteria. There’s an irreducible (name removed by moderator)ut from dumb statistical consensus, and ‘scientific’ status is sometimes negotiated as much as argued.

As to falsifiability, where ID has made some specific statements they have been falsified, though often those statements are about evolution rather than about ID itself.

At its heart ID theory is something like: “A designer (or designers) with unknown powers did something at some time in some place.” Until there is a lot more detail added to that it will be very difficult to falsify ID.

rossum

As far as Behe and DBB goes, that’s just a straw man, it seems to me.

 

[grannymh]

But that misses the point. We can apprehend the general notion of design and we *can *apply this notion in the manner of a scientific hypothesis about irreducible complexity to biological mechanisms and it is possible that our best analysis of certain phenomena could result in intelligent design being the best explanation for what we see in certain cases. And it is possible for such results to later be falsified (as history has shown).

Somehow, I thought the idea of falsification meant that an outside situation or experiment would have the capability to falsify a conclusion – not that the conclusion must be shown to be false.

 

[rossum]

Unfortunately you answered a rhetorical question here and missed the point.

Sorry. Sometimes I am too literal for my own good.

None of the points here point to an independent assessment of paleolithic man himself.

It would be nice if we could have some live palaeolithic men to study, but we don’t. The closest we have are some isolated tribes with similar technologies. We can only work with the knowledge we have, not with the knowledge we would like to have.

Each of these bits of evidence is based on our ability to immediately recognize the artifacts of intelligent beings. All subsequent construction of knowledge is based on this primary source of data, isn’t it?

I disagree. We may not be able to recognise alien design, or divine design. We do have enough knowledge of humans, and of human design, to have a reasonably good chance of recognising human design.

Oh? Can you please explain this? I thought that “Evolution cannot produce Irreducible Complexity” was true by definition. How was this claim falsified?

There are a number of studies. The basic mathod is 1) Add a new part. 2) Make the new part essential. For specific examples see Lenski et al (2008) on the evolution of citrate eating E. coli, Lenski et al (2003) on the evolution of complex features in a digital environment and Behe and Snoke (2004) on the evolution of simple IC systems. Yes, it is the same Behe. Different evolutionary paths are discussed in Thornhill and Ussery (2000). Of the four paths they deal with, only one, the Direct path, cannot result in an IC system. The other three: Parallel, Removing Redundancy and Adoption can produce IC systems.

It is a complement to Professor Behe that his work on IC has resulted in a lot of interesting work from other scientists. He asked a useful and valid question.
If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.

– Darwin, Origin, Chapter Six
He did not get the answer he expected, but that is often the case in science.

One of my criticisms of ID is that there is no equivalent to the Darwin quote in any ID publication: “If it could be demonstrated that … then ID theory would absolutely break down.”

As far as Behe and DBB goes, that’s just a straw man, it seems to me.

Behe did not make any positive statements about ID, at least not any that were scientifically falsifiable. He made a general statement about IC: “IC cannot evolve” and he then proposed a number of examples of IC systems. Some of those systems have been shown not to be IC by Behe’s definition and some have been shown to be evolvable.

Behe himself has now, correctly, changed his position. He proposed a hypothesis: “IC cannot evolve”. Experiments showed that this hypothesis was incorrect so, as any good scientist should, he modified his hypothesis to include the new experimental results: “IC systems are unlikely to evolve”. The Behe and Snoke paper I referred to above was his first cut at calculating just how unlikely it is that a simple IC system will evolve. The answer turns out to be about 20,000 years in a population of one billion bacteria. That is a small population for bacteria, you have over a trillion in your gut.

rossum

 

[edwest2]

Intelligent Design does not require falsification to be observed. Here, it is quite clear that an anti-religious bias prevails. Ergo, if ID is true, then “they” would try to get it into the science classroom.

Even if ID textbooks could pass muster with the ACLU, who would scrupulously look for any word like God, Creator, etc., it would still not be good enough for the anti-religion zealots who would see this as yet another attempt to encourage people to think about God as opposed to purely mechanical causes that render God, religion and religious beliefs meaningless. This would throw a big monkey wrench into the secularization movement.

Scientists are spending time and money at SETI thinking they could get a signal from an intelligence they don’t even know exists. ID works because nature is designed. It is only one’s choice to ignore that that makes it a nonissue for some.

And the nonsense argument that a “designer” could design anything to look like anything is irrational. A 1957 Buick four door looks like a 1957 Buick four door. I’m certain no one listening to Bach would say to themselves: How did that random noise come together so beautifully?

It is equally nonsensical to believe that only human designed objects could be recognized by humans. There is no doubt that if an artificial object was photographed in space, scientists would not assume it came about naturally.

God bless,
Ed

 

[Betterave]

Sorry. Sometimes I am too literal for my own good.

It would be nice if we could have some live palaeolithic men to study, but we don’t. The closest we have are some isolated tribes with similar technologies. We can only work with the knowledge we have, not with the knowledge we would like to have.

I disagree. We may not be able to recognise alien design, or divine design. We do have enough knowledge of humans, and of human design, to have a reasonably good chance of recognising human design.

There are a number of studies. The basic mathod is 1) Add a new part. 2) Make the new part essential. For specific examples see Lenski et al (2008) on the evolution of citrate eating E. coli, Lenski et al (2003) on the evolution of complex features in a digital environment and Behe and Snoke (2004) on the evolution of simple IC systems. Yes, it is the same Behe. Different evolutionary paths are discussed in Thornhill and Ussery (2000). Of the four paths they deal with, only one, the Direct path, cannot result in an IC system. The other three: Parallel, Removing Redundancy and Adoption can produce IC systems.

It is a complement to Professor Behe that his work on IC has resulted in a lot of interesting work from other scientists. He asked a useful and valid question.
If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.

– Darwin, Origin, Chapter Six
He did not get the answer he expected, but that is often the case in science.

One of my criticisms of ID is that there is no equivalent to the Darwin quote in any ID publication: “If it could be demonstrated that … then ID theory would absolutely break down.”

Behe did not make any positive statements about ID, at least not any that were scientifically falsifiable. He made a general statement about IC: “IC cannot evolve” and he then proposed a number of examples of IC systems. Some of those systems have been shown not to be IC by Behe’s definition and some have been shown to be evolvable.

Behe himself has now, correctly, changed his position. He proposed a hypothesis: “IC cannot evolve”. Experiments showed that this hypothesis was incorrect so, as any good scientist should, he modified his hypothesis to include the new experimental results: “IC systems are unlikely to evolve”. The Behe and Snoke paper I referred to above was his first cut at calculating just how unlikely it is that a simple IC system will evolve. The answer turns out to be about 20,000 years in a population of one billion bacteria. That is a small population for bacteria, you have over a trillion in your gut.

rossum

okay, thanks for the comments. I’ll reply in more detail later, but I was wondering if you would like to comment on greylorn’s praise of Behe in the thread “God did not create the universe…” He seems to know more about the historical/legal/scientific development of the issue than I do (but maybe less than you do?).

And just one question. Is it possible to fill in this blank: “If it could be demonstrated that … then evolutionary theory would absolutely break down”?

 

[rossum]

okay, thanks for the comments. I’ll reply in more detail later, but I was wondering if you would like to comment on greylorn’s praise of Behe in the thread “God did not create the universe…” He seems to know more about the historical/legal/scientific development of the issue than I do (but maybe less than you do?).

I will have a look at it, but I am away on Thursday and Friday so I may not respond there immediately.

And just one question. Is it possible to fill in this blank: “If it could be demonstrated that … then evolutionary theory would absolutely break down”?

You are a very naughty boy. Off to bed with you and you won’t get any pudding.

The words around the ellipsis are taken from the quote from Darwin that I included in my post. There is another quote in the same chapter of Origin giving a second possible falsification. Here thay both are:If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.

If it could be proved that any part of the structure of any one species had been formed for the exclusive good of another species, it would annihilate my theory, for such could not have been produced through natural selection.

• both from Chapter Six of “On the Origin of Species” by Charles Darwin
  As a good scientist Darwin provided ways to falsify his theory. Evolution has always been falsifiable. Behe’s concept of Irreducible Complexity was an attempt to show an example of the first of these two falsifications.

rossum

 

[grannymh]

If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.

The human person is the pinnacle of complexity.

 

[Betterave]

I will have a look at it, but I am away on Thursday and Friday so I may not respond there immediately.

You are a very naughty boy. Off to bed with you and you won’t get any pudding.

The words around the ellipsis are taken from the quote from Darwin that I included in my post. There is another quote in the same chapter of Origin giving a second possible falsification. Here thay both are:If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.

If it could be proved that any part of the structure of any one species had been formed for the exclusive good of another species, it would annihilate my theory, for such could not have been produced through natural selection.

• both from Chapter Six of “On the Origin of Species” by Charles Darwin
  As a good scientist Darwin provided ways to falsify his theory. Evolution has always been falsifiable. Behe’s concept of Irreducible Complexity was an attempt to show an example of the first of these two falsifications.

rossum

Well I’m sorry for being a naughty boy, but it seems that if we accept Darwin’s claim, which is a conditional:

If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, then] my theory would absolutely break down

then we are faced with two possibilities:

a) it indeed could, in principle, be demonstrated that a complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications - in which case we must accept the scientific status of Behe’s IC-ID project; or

b) the existence of a complex organ which could not possibly have been formed by numerous, successive, slight modifications in fact could not, in principle, be demonstrated - in which case we must admit that Darwin’s theory is just as unfalsifiable as Behe’s.

Correct?

p.s. This problem seems to be even more acute, i.e., obviously a case of b), for our good scientist Darwin’s second abstract gesture towards a ‘way’ to falsify his theory… so feel free to comment on that one too.

 

[rossum]

Well I’m sorry for being a naughty boy, but it seems that if we accept Darwin’s claim, which is a conditional:

If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, then] my theory would absolutely break down

then we are faced with two possibilities:

a) it indeed could, in principle, be demonstrated that a complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications - in which case we must accept the scientific status of Behe’s IC-ID project; or

b) the existence of a complex organ which could not possibly have been formed by numerous, successive, slight modifications in fact could not, in principle, be demonstrated - in which case we must admit that Darwin’s theory is just as unfalsifiable as Behe’s.

Correct?

Yes. No scientist proposed a theory which has already been falsified, except by mistake. Hence a lot of falsificatons are in a conditional form. You are correct to say that Behe’s IC was a valid attempt to meet Darwin’s possible falsification. However, the problem with Behe’s IC is that IC systems can evolve. They cannot evolve by direct methods, true, but they can evolve by indirect methods. We have computer experiments with a complete listing of the changes to get from a non-IC starting point to an IC conclusion. We have biological experiments with a reasonable complete sequence of changes leading to an IC system to digest citrate. In short, experiments have shown that there is a sequence of “numerous, successive, slight modifications” which can result in an IC final system. While Behe’s IC was an interesting (re)discovery which sparked a lot of worthwhile further work it did not meet the criteria for Darwin’s proposed falsification.

Behe’s IC idea was indeed scientific, though it did not have as much to do with ID as some people think. It was a valid scientific attempt to falsify evolution. It did not provide any evidence in favour of IC. At most it could have shown that “the bacterial flagellum did not evolve”. That says nothing about ID since the scientific default is “we don’t know”. In order to move science from “we don’t know” to “the flagellum was designed” positive evidence in favour of ID is needed. Proof that rossum did not steal the cookies is not acceptable as evidence that Betterave did steal the cookies.

As an illustration of an IC system evolving, start with some stepping stones across a river that let you cross the river dry-shod:

0 0 0 0 0

Now lay a log across the stepping stones:

_________
0 0 0 0 0

Now remove the middle stepping stones:

_________
0 . . . 0

The resulting bridge is IC. If you remove either end stone or the log then you can no longer cross the river dry-shod. Each stage allows you to cross the river dry-shod from the initial stepping stones to the final bridge. What has happened is that we did not go directly for a bridge, we used the stepping stones as an intermediate and then removed the excess stones after placing the log. Thornhill and Ussery call this “Elimination of Functional Redundancy”, though more informally it is called “Scaffolding”. Parts are used temporarily and then discarded like the scaffolding used to construct an arch.

p.s. This problem seems to be even more acute, i.e., obviously a case of b), for our good scientist Darwin’s second abstract gesture towards a ‘way’ to falsify his theory… so feel free to comment on that one too.

I can see no problem with either proposed way to falsify. That Behe’s IC failed does not mean that another scientist could come up with something better. Indeed there is a consensus among biologists that there are disconnected islands in ‘DNA-space’ that cannot be reached by current life on Earth because there are no viable intermediates. So far all the life that we have found has enough intermediate stepping stones to allow for universal common descent.

We see many species providing structures to help other species, but there is always some advantage to the providing species. Trees provide fruit in return for the advantage of scattering their seeds further away from the parent tree. What has not been found so far is a species that does something similar without getting any return.

rossum

 

[grannymh]

Yes. No scientist proposed a theory which has already been falsified, except by mistake.

Before replying, my position is one of deep respect for the women and men working within the scientific framework. My comments below are part of their protocol. The comments are intended to point out some of the things in research which should be looked at before interpreters jump to unwarranted applications.

Coming from an analytical point of view by way of general journalism, I would like to add to the above sentence: “No scientist proposed a theory which has already been falsified, except by mistake.”

First, how is a theory falsified? Was falsification checked within the research itself? Sometime ago, Science magazine reported a research project where there may have been sloppy record keeping, maybe not. In this case, one would need to replicate the methods and materials used.

Any research hypothesis should be examined to see if it is possible given the actual materials and methods used. Can the materials, number, variety, and source realistically warrant the conclusion? One of the valuable results of reading posts on carbon dating was to discover all the outside things which could influence the conclusion. Thus, lab procedures, including computer simulations, should be considered.

One of the difficulties I have with the concept of falsification is that it looks like a rubber stamp which can automatically stop anything.

We would be using our computer by candle light if Edison had stopped with the first falsification.

Blessings,
granny

The quest for knowledge is worthy of the misadventures of the journey.

 

[buffalo]

Yes. No scientist proposed a theory which has already been falsified, except by mistake. Hence a lot of falsificatons are in a conditional form. You are correct to say that Behe’s IC was a valid attempt to meet Darwin’s possible falsification. However, the problem with Behe’s IC is that IC systems can evolve. They cannot evolve by direct methods, true, but they can evolve by indirect methods. We have computer experiments with a complete listing of the changes to get from a non-IC starting point to an IC conclusion. We have biological experiments with a reasonable complete sequence of changes leading to an IC system to digest citrate. In short, experiments have shown that there is a sequence of “numerous, successive, slight modifications” which can result in an IC final system. While Behe’s IC was an interesting (re)discovery which sparked a lot of worthwhile further work it did not meet the criteria for Darwin’s proposed falsification.

Behe’s IC idea was indeed scientific, though it did not have as much to do with ID as some people think. It was a valid scientific attempt to falsify evolution. It did not provide any evidence in favour of IC. At most it could have shown that “the bacterial flagellum did not evolve”. That says nothing about ID since the scientific default is “we don’t know”. In order to move science from “we don’t know” to “the flagellum was designed” positive evidence in favour of ID is needed. Proof that rossum did not steal the cookies is not acceptable as evidence that Betterave did steal the cookies.

As an illustration of an IC system evolving, start with some stepping stones across a river that let you cross the river dry-shod:

0 0 0 0 0

Now lay a log across the stepping stones:

_________
0 0 0 0 0

Now remove the middle stepping stones:

_________
0 . . . 0

The resulting bridge is IC. If you remove either end stone or the log then you can no longer cross the river dry-shod. Each stage allows you to cross the river dry-shod from the initial stepping stones to the final bridge. What has happened is that we did not go directly for a bridge, we used the stepping stones as an intermediate and then removed the excess stones after placing the log. Thornhill and Ussery call this “Elimination of Functional Redundancy”, though more informally it is called “Scaffolding”. Parts are used temporarily and then discarded like the scaffolding used to construct an arch.

I can see no problem with either proposed way to falsify. That Behe’s IC failed does not mean that another scientist could come up with something better. Indeed there is a consensus among biologists that there are disconnected islands in ‘DNA-space’ that cannot be reached by current life on Earth because there are no viable intermediates. So far all the life that we have found has enough intermediate stepping stones to allow for universal common descent.

We see many species providing structures to help other species, but there is always some advantage to the providing species. Trees provide fruit in return for the advantage of scattering their seeds further away from the parent tree. What has not been found so far is a species that does something similar without getting any return.

rossum

http://www.discovery.org/scripts/viewDB/filesDB-download.php?command=download&id=730

http://www.discovery.org/scripts/viewDB/filesDB-download.php?command=download&id=729

http://www.discovery.org/scripts/viewDB/filesDB-download.php?command=download&id=728

 

[rossum]

http://www.discovery.org/scripts/viewDB/filesDB-download.php?command=download&id=730

http://www.discovery.org/scripts/viewDB/filesDB-download.php?command=download&id=729

http://www.discovery.org/scripts/viewDB/filesDB-download.php?command=download&id=728

http://cache2.asset-cache.net/xc/30...36655F89EF51227DA9754F59C09C55223CE6E4BAF89B1

rossum

 

[rossum]

First, how is a theory falsified? Was falsification checked within the research itself? Sometime ago, Science magazine reported a research project where there may have been sloppy record keeping, maybe not. In this case, one would need to replicate the methods and materials used.

A theory can be falsified in many ways. Sloppy or incorrect record keeping may be one way, though sloppy records may actually turn out to be correct. Failing to read the right Journals is another way – Mendel’s paper was ignored for a long time because it was in such an obscure Journal. A scientist who had failed to read that paper could propose an incorrect theory quite innocently.

The normal way to falsify a theory is for the theory to make predictions that are a) derived from the theory and b) different from other competing theories. For example when astronomers were debating the merits of the Big Bang and Steady State theories both sides made predictions about what we should observe in the universe now. Those predictions were derived from their respective theories and gave different predictions. BB predicted the existence of the CMBR - the remnant of the Big Bang - and its temperature, about 3°K. SS predicted that there would not be any CMBR. When the CMBR was found, with a temperature of 2.73°K, the Steady State theory took a major hit.

One of the difficulties with ID is the problem with even making the predictions (hypotheses) in the first place. They claim to be able to detect design, which at least should enable them to differentiate between two different pieces of DNA, one designed and the other random:* Designed: ACACATATATCATGAATCTCCTGAGACGAGAGCATCGGGAACGAGGACTGAGATAATGCT

• Random: TCGGGCTTGTAAATAAAGCCAGGTAGGACTATACGGAGGACCGAAAGTTTGGTATCCTCA

I have not seen anything from the ID side that shows any research on whether ID can use its methods to pass this simple test. I have very little doubt that a cryptanalyst would be able to differentiate the two as would most biologists, with a little thought. ID seems to think that politics and writing press releases is more important than doing the basic science.

One of the difficulties I have with the concept of falsification is that it looks like a rubber stamp which can automatically stop anything.

It isn’t. but it does raise warning flags. For example, it is currently difficult to falsify String Theory because many of the predictions it makes are beyond the limits of our current techniques to measure. That may be changing in the near future since we may possibly have found a different, measurable, way to test it: Scientists say they can now Test String Theory.

We would be using our computer by candle light if Edison had stopped with the first falsification.

Every failure was a falsification of one theory, so Edison moved on to the next theory. In every case he rejected the falsified theory:* Theory: Iron filaments work. False.

• Theory: Aluminium filaments work. False.
• Theory: Tungsten filaments work. Correct.

rossum

 

[buffalo]

http://cache2.asset-cache.net/xc/30...36655F89EF51227DA9754F59C09C55223CE6E4BAF89B1

rossum

Reflect on the complexity of the scaffold itself.

Now after the arch is all assembled remove the head piece.

and rossum are we still working on the complexity stuff or are you dropping it?

 

[edwest2]

A theory can be falsified in many ways. Sloppy or incorrect record keeping may be one way, though sloppy records may actually turn out to be correct. Failing to read the right Journals is another way – Mendel’s paper was ignored for a long time because it was in such an obscure Journal. A scientist who had failed to read that paper could propose an incorrect theory quite innocently.

The normal way to falsify a theory is for the theory to make predictions that are a) derived from the theory and b) different from other competing theories. For example when astronomers were debating the merits of the Big Bang and Steady State theories both sides made predictions about what we should observe in the universe now. Those predictions were derived from their respective theories and gave different predictions. BB predicted the existence of the CMBR - the remnant of the Big Bang - and its temperature, about 3°K. SS predicted that there would not be any CMBR. When the CMBR was found, with a temperature of 2.73°K, the Steady State theory took a major hit.

One of the difficulties with ID is the problem with even making the predictions (hypotheses) in the first place. They claim to be able to detect design, which at least should enable them to differentiate between two different pieces of DNA, one designed and the other random:* Designed: ACACATATATCATGAATCTCCTGAGACGAGAGCATCGGGAACGAGGACTGAGATAATGCT

• Random: TCGGGCTTGTAAATAAAGCCAGGTAGGACTATACGGAGGACCGAAAGTTTGGTATCCTCA

I have not seen anything from the ID side that shows any research on whether ID can use its methods to pass this simple test. I have very little doubt that a cryptanalyst would be able to differentiate the two as would most biologists, with a little thought. ID seems to think that politics and writing press releases is more important than doing the basic science.

It isn’t. but it does raise warning flags. For example, it is currently difficult to falsify String Theory because many of the predictions it makes are beyond the limits of our current techniques to measure. That may be changing in the near future since we may possibly have found a different, measurable, way to test it: Scientists say they can now Test String Theory.

Every failure was a falsification of one theory, so Edison moved on to the next theory. In every case he rejected the falsified theory:* Theory: Iron filaments work. False.

• Theory: Aluminium filaments work. False.
• Theory: Tungsten filaments work. Correct.

rossum

It’s interesting that you include the cliche about press releases. Have you read Signature in the Cell? I suggest you do. As the complexity level in the cell goes up, and a recent finding has added to its complexity, the mathematical odds of it assembling itself go down.

It is obvious you are sensitive to an ideology (the Wedge Document) that will take over the world or at least the science classroom I get that. In the meantime, when valid observations about cellular complexity and function are made, I will take them seriously. I don’t care who makes the statements as far as their connection to some Institute is concerned. I don’t want to become personal friends with these people. Good data is good data and that’s the key thing. That’s it.

If scientists launched a mission to examine an artificial object between the earth and the moon, the findings would be the data. Not, it’s impossible that alien life exists so this thing shouldn’t exist. Obviously, someone made this artificial object. The data would not require any sort of falsification to be valid. ID is about making valid observations about cellular structure and function. It is convincing not because I believe in some Wedge but because the data points to a conclusion.

Peace,
Ed

 

[rossum]

Reflect on the complexity of the scaffold itself.

Now after the arch is all assembled remove the head piece.

and rossum are we still working on the complexity stuff or are you dropping it?

Reflect on the complexity of the scaffolding used for this arch:

PhotoSeek.com quick links / site map / index / contents

Quick links to all PhotoSeek.com travel & camera articles, reviews, book recommendations. Trip planning tips. Buy exquisite photographs of nature & travel.

photoseek.com

rossum

 

[rossum]

As the complexity level in the cell goes up, and a recent finding has added to its complexity, the mathematical odds of it assembling itself go down.

Complexity is not a problem for either chemistry or evolution. Both can produce complex objects. Do you think a snowflake is complex? Yet it can assemble itself through basic physics and chemistry. What you have to do, and which Meyer has failed to do, is not just say, “gosh, isn’t that complex,” but to go on to show that normal mechanisms cannot do the work. Since normal mechanisms are not limited to random assembly it is not enough just to calculate the odds of random assembly. Neither chemistry nor evolution are “random assembly” - water does not “randomly assemble” from hydrogen and oxygen, there are known non-random chemical mechanisms operating. You always see H2O and not H3O or H4O. Any calculations ID does have to take into account all relevant non-random mechanisms. Failing to do so invalidates any conclusions drawn from the incomplete calculations.

I can show that the chance of God randomly assembling is larger than the complexity of any cell. However, the calculation is useless because God did not randomly self-assemble. The same with ID calculations.

If scientists launched a mission to examine an artificial object between the earth and the moon, the findings would be the data.

You are assuming the result. The scientists will examine an object between the Earth and the Moon; whether or not it is artificial is a matter for analysis of the data.

ID is about making valid observations about cellular structure and function.

ID makes valid use of other scientists’ work looking at the complexity of cells. It makes invalid calculations about the processes which assembled those cells. Finally it then tries to draw conclusions from those invalid calculations. GIGO.

rossum

 

[edwest2]

Enjoy missing the point if you like. The analysis of an artificial object between the earth and the moon concludes it is not natural - at all. That is the data. Now, based on a philosophical bias, there can only be one answer as to its possible builder.

You are on a Catholic forum and apparently, in a way, you still don’t realize that. I know there are people who either dismiss the idea of God/gods, and think beliefs are so much nonsense, but there is something there. If you continue to post while not acknowledging what has been revealed to man, that’s one thing, but I should point out that continuing to do so does not make God go away.

But back to ID. The data shows design.

God bless,
Ed

 

[buffalo]

Reflect on the complexity of the scaffolding used for this arch:

PhotoSeek.com quick links / site map / index / contents |

rossum

Are you equating the erosion of this arch with deleterious mutations?

 

[Betterave]

It would be nice if we could have some live palaeolithic men to study, but we don’t. The closest we have are some isolated tribes with similar technologies. We can only work with the knowledge we have, not with the knowledge we would like to have.

Mutatitis mutandis, same goes for studying biological design.

I disagree. We may not be able to recognise alien design, or divine design. We do have enough knowledge of humans, and of human design, to have a reasonably good chance of recognising human design.

We may not, correct; but we also may.

There are a number of studies. The basic mathod is 1) Add a new part. 2) Make the new part essential. For specific examples see Lenski et al (2008) on the evolution of citrate eating E. coli, Lenski et al (2003) on the evolution of complex features in a digital environment and Behe and Snoke (2004) on the evolution of simple IC systems. Yes, it is the same Behe. Different evolutionary paths are discussed in Thornhill and Ussery (2000). Of the four paths they deal with, only one, the Direct path, cannot result in an IC system. The other three: Parallel, Removing Redundancy and Adoption can produce IC systems.

Thank you, that’s very informative, but I think the issue may be more complex than you suggest here. IC is a conceptual construct - it means whatever we mean it to mean. If we define it as the benchmark of ID, then it cannot be proven that IC systems can evolve. On this reading, if a putative IC system is shown to be evolvable, then it has been shown not to be an IC system. Is there a compelling reason not to interpret the concept this way?

It is a complement to Professor Behe that his work on IC has resulted in a lot of interesting work from other scientists. He asked a useful and valid question.
If it could be demonstrated that any complex organ existed, which could not possibly have been formed by numerous, successive, slight modifications, my theory would absolutely break down.

– Darwin, Origin, Chapter Six
He did not get the answer he expected, but that is often the case in science.

One of my criticisms of ID is that there is no equivalent to the Darwin quote in any ID publication: “If it could be demonstrated that … then ID theory would absolutely break down.”

Isn’t the obvious equivalent: “If it could be demonstrated that it is not true for any of the complex organs which exist that they could not possibly have been formed by numerous, successive, slight modifications, ID theory would absolutely break down”?

Behe did not make any positive statements about ID, at least not any that were scientifically falsifiable. He made a general statement about IC: “IC cannot evolve” and he then proposed a number of examples of IC systems. Some of those systems have been shown not to be IC by Behe’s definition and some have been shown to be evolvable.

Behe himself has now, correctly, changed his position. He proposed a hypothesis: “IC cannot evolve”. Experiments showed that this hypothesis was incorrect so, as any good scientist should, he modified his hypothesis to include the new experimental results: “IC systems are unlikely to evolve”. The Behe and Snoke paper I referred to above was his first cut at calculating just how unlikely it is that a simple IC system will evolve. The answer turns out to be about 20,000 years in a population of one billion bacteria. That is a small population for bacteria, you have over a trillion in your gut.

It seems that the word ‘evolve’ is a tricky one here. In the context of a scientific theory it means that there is a specific mechanism by which A can be conceived to evolve into B. The statement “IC cannot evolve” means that what we understand about evolutionary mechanisms cannot account for a putative case of IC. But evolve can also just indicate “spontaneous organization” and it seems that that might be the operative sense in the claim “IC systems are unlikely to evolve.” In other words, the two claims could be interpreted as complementary, not contradictory. (N.B.: I’m not claiming that this is how Behe understands it, just that he perhaps could well understand it in this way.)