Should science be secular?

[colmcille1]

Could you repeat that in English please?

If this kind of irrational drivel that doesn’t even make grammatical sense let alone anything else is what passes for reason from a human made in his image, then I thank God (or whatever) that I’m an ape.

Well now, not only do atheists lack belief in God, they obviously sorely lack any vestige of a sense of humour!
Hey folks, my post just caused an atheist to say “…I thank God…” or am I falling into the trap which atheists step willingly into namely: taking things out of context?!
(Btw, posters, I wonder is there a new thread lurking in there? Does atheism find humour anathema? Wouldn’t be much fun, I guess, as all the gags would be coming from our side!)
I’ll give it to you in Irish(Gaelic), sir, as I realize you can’t grasp ideas in English: Ba mhaith liom creideamh, dochas agus deirc.

 

[edwest2]

This sentence presumes design evidence before one does the looking. THAT is bias. I would LOVE evidence of a God or creator. That would SATISFY me greatly, and make the owner of that copyrighted material famously rich and renowned.

Meanwhile we wait, and wait.

ps: you have inaccurately summarized what Einstein called his mistake. But I am not surprised that you did this. It shows your bias.

Uh, what are you waiting for? “Show me god. If you can show me god I might believe in him.” I heard that in the 1970s.

Here’s an article that might interest you:

catholiceducation.org/articles/religion/re0447.html

God is aware of our disbelief, including some Catholics.

God bless,
Ed

 

[Charlemagne_II]

larkin

*ps: you have inaccurately summarized what Einstein called his mistake. But I am not surprised that you did this. It shows your bias. *

Wherein was the innacuracy? That you couldn’t point it out suggests that you are making up inaccuracies out of whole cloth.

It’s a well know story about George LeMaitre correcting Einstein’s math in order to uncover the Big Bang. It’s also well known that Einstein had a bias in favor of an eternal and infinite universe before the Big Bang showed him to be wrong. You apparently are not familiar with this? And Einstein later admitted his mistake to LeMaitre.

Do you know any of this? I’m not surprised if you don’t

 

[larkin31]

larkin

*ps: you have inaccurately summarized what Einstein called his mistake. But I am not surprised that you did this. It shows your bias. *

Wherein was the innacuracy? That you couldn’t point it out suggests that you are making up inaccuracies out of whole cloth.

It’s a well know story about George LeMaitre correcting Einstein’s math in order to uncover the Big Bang. It’s also well known that Einstein had a bias in favor of an eternal and infinite universe before the Big Bang showed him to be wrong. You apparently are not familiar with this? And Einstein later admitted his mistake to LeMaitre.

Do you know any of this? I’m not surprised if you don’t

You are doing better with this description. You left God and/or a Designer out of the summary.

I knew you could do it.

 

[colmcille1]

Could you repeat that in English please?

If this kind of irrational drivel that doesn’t even make grammatical sense let alone anything else is what passes for reason from a human made in his image, then I thank God (or whatever) that I’m an ape.

Btw, I see by your name tab that in the space provided for religion, you put down “atheist”!
And by your kind of “irrational drivel”, atheism is a religion? Thank you. Now I truly have your full measure! A weeee dhraaam o’ atheism, bonny folk!

 

[j1akey]

colmcille1:

Btw, I see by your name tab that in the space provided for religion, you put down “atheist”!
And by your kind of “irrational drivel”, atheism is a religion? Thank you. Now I truly have your full measure! A weeee dhraaam o’ atheism, bonny folk!

/palmface

Ok, lets not go into the “atheism is a religions” garbage It’s a spot on the forum to announce what you do or do not believe in. “Atheist” describes that for some people. Grasping at straws here a little I think.

 

[Moonstruck888]

Btw, I see by your name tab that in the space provided for religion, you put down “atheist”!
And by your kind of “irrational drivel”, atheism is a religion? Thank you. Now I truly have your full measure! A weeee dhraaam o’ atheism, bonny folk!

Atheism is a word that describes my thoughts on religion.

From the Greek, A - Without, Theos - God…

Good day to you.

 

[Charlemagne_II]

larkin

You are doing better with this description. You left God and/or a Designer out of the summary.

Just to please your atheistic bias!

 

[larkin31]

larkin

You are doing better with this description. You left God and/or a Designer out of the summary.

Just to please your atheistic bias!

no

it was wrong to suggest that Einstein said that his mistake was not to include God. That is just blatantly wrong.

 

[buffalo]

You deserve no break. Evo’s primarily base their work on chemistry, physics, archeology, geology, and mathematics. These are based on empirical material evidence, and their conclusions, properly limited, go no further. They work in the material world and speak of the material world. That is their proper purview, like it or not. You simply whine that scientists don’t explore the supernatural. Which is absurdly non-scientific.

This is virtually so self-evident that it could be in an elementary school book. It is meaningless in a scholarly sense of pursuing scientific knowledge. “Designs” in nature OF COURSE are seen everywhere: nature has patterns of all kinds.

I don’t know why I bother with you.

I already went over this.

We are not talking about patterns. We are talking about designs.

Natural patterns never contain symbols. Designs always contain patterns.

 

[Moonstruck888]

no

it was wrong to suggest that Einstein said that his mistake was not to include God. That is just blatantly wrong.

Einstein’s mistake was to put his own reason before the scientific method. When the data didn’t backup his personal perjudices, he ignored the data.

The moral of the story being that even if you have an intellect that’s off the charts, you’re still not immune to the worst cancers of being horribly, stupidly wrong.

 

[buffalo]

Correct, a.

Let larkin know the difference between patterns and designs.

Now we do know the DNA language/code is contained in humans. Language, symbols and maps always come from a mind.

 

[larkin31]

Let larkin know the difference between patterns and designs.

Now we do know the DNA language/code is contained in humans. Language, symbols and maps always come from a mind.

Can you remind me where the ignore button is? I just looked for it and could not find it.

 

[Moonstruck888]

Let larkin know the difference between patterns and designs.

Now we do know the DNA language/code is contained in humans. Language, symbols and maps always come from a mind.

CCATAGCACCTACCATGGAAACGACCATAACACCTACCTAAAGGGACG

What did I just say?

 

[JohnDamian]

I already went over this.

We are not talking about patterns. We are talking about designs.

Natural patterns never contain symbols. Designs always contain patterns.

An apparrently designed thing only requires a cause that could bring about a state of affairs that resembles that design; it does not imply an intelligence; or a designer; as that is not an essential predicate of an accidentally ordered sequence leading to a specific design. Thus we have no reason to presuppose a design is per se a composite or a specifically composed object. It would be misleading and imprecise to suppose a cause greater than a necessary cause for a particular object.

 

[Soulewolf]

Well i think this is rather simple. If we can employ a “Divine Constant” that allows us to more accurately predict the universe mathematically, then science should not be secular.

The real question is if there is a logical explanation for why the Divine Constant exists and why its predictions are accurate, could science still be said to be non secular? Maybe God can be found in String Theory eh?

 

[buffalo]

Can you remind me where the ignore button is? I just looked for it and could not find it.

I am replying in the back fence thread.

All you need to do is offer a refutation. Your comments are not refutations.

See you all in the back fence.

 

[Moonstruck888]

I am replying in the back fence thread.

All you need to do is offer a refutation. Your comments are not refutations.

See you all in the back fence.

In other words, “I’m retracting my head back into it’s shell and covering my ears.”

 

[tonyrey]

You deserve no break. Evo’s primarily base their work on chemistry, physics, archeology, geology, and mathematics. These are based on empirical material evidence, and their conclusions, properly limited, go no further. They work in the material world and speak of the material world. That is their proper purview, like it or not. You simply whine that scientists don’t explore the supernatural. Which is absurdly non-scientific.

This is virtually so self-evident that it could be in an elementary school book. It is meaningless in a scholarly sense of pursuing scientific knowledge. “Designs” in nature OF COURSE are seen everywhere: nature has patterns of all kinds.

I don’t know why I bother with you.

I don’t know why you bother with anyone on this forum who disagrees with you. You are unable to recognise the elementary distinction between the pattern of inanimate objects and the design of a living organism…

 

[larkin31]

I don’t know why you bother with anyone on this forum who disagrees with you. You are unable to recognise the elementary distinction between the pattern of inanimate objects and the design of a living organism…

I fully understand this difference. I was referring above to patterns and structures in living organisms as well as those in animate objects.