Should science be secular?

[Charlemagne_II]

There is no reason why science should not be completely secular. However, secularism does not require the assumption that no knowledge can be true except scientific knowledge. It is the error and tragedy of modern science that it has set up a wall between itself and any possible truth existing beyond its own methodology of attainment. This is rightly called scientism … a dogma that relatively few scientists today are large minded enough to overcome because they have so thoroughly succumbed to its seductive power.

Scientism is really a narrow kind of superstition. The so-called superstition of religion was always wide enough to embrace both God and science. The superstition of science, it seems, cannot get beyond a slavish genuflection to itself. Religion never did more than to discipline science, Galileo’s house arrest being the worst case scenario. Scientism would like to annihilate religion, and its bishops of bombast (Freud, Dawkins, etc.) never lose an opportunity to predict with great relish the death of God.

 

[tonyrey]

Physicalism is the thesis that everything is derived from, and dependent on, physical objects. It is absurd because the power of reason is used to reduce itself to a product of unreasoning events…

You have unwittingly give the game away! The parts of a car did not assemble themselves fortuitously…

If you believe all your thoughts have physical causes you cannot possibly have control over them!

That’s an absurd claim. It has no basis, and you give no “reason” for it.

I have given you a reason you have ignored. How can you control your thoughts if they have physical causes? Can you override the physical causes? If so **how **do you do it? Why do you need to add another cause? It is superfluous if your thoughts already have a physical explanation…

Self-control becomes an illusion because there is no self in your scheme of things…

.
The “self” is the workings of my neural net in coordination with each other.

In that case “you” don’t exist. There is only a body the workings of which are determined entirely by physical events so self-control must be a myth…

On the contrary it is directly related because you believe science can in principle explain all personal activity.

No, I have not said that it “can”. Presently, it cannot. Stop misrepresenting my statements. I consider it dishonest (from an adult).

What you consider is beside the point because the fact remains that you have just stated that your self is “the workings of my neural net” - which, I am sure you will agree, science can explain in principle. If not why not? Isn’t it a physical process?

In effect you are presuming that religion explains nothing

WRONG! I have made no comment on what I think that religion explains. You really are a poor thinker in this conversation. You constantly make associated assumptions and then ascribe them to me erroneously.

You made no comment but you are failing to evade the implications of your answers:

Do you think it is reasonable to attribute your power of reasoning to the fortuitous combinations of atomic particles and random genetic mutations?

Oh, yes. The electrochemical processes of certain forms of thinking and emotions are well understood by now.

To derive mind from that which is mindless? Autonomy from that which lacks autonomy? Value from that which is valueless? Significance from that which is insignificant? Persons from that which is impersonal?
Yes, certainly.

Yet now you are unwilling to admit you believe religion explains nothing! Why are you an agnostic? What is there left of importance to explain when science is supposed to explain **in principle **every aspect of human activity?

 

[larkin31]

There is no reason why science should not be completely secular. However, secularism does not require the assumption that no knowledge can be true except scientific knowledge. It is the error and tragedy of modern science that it has set up a wall between itself and any possible truth existing beyond its own methodology of attainment. This is rightly called scientism … a dogma that relatively few scientists today are large minded enough to overcome because they have so thoroughly succumbed to its seductive power.

Scientism is really a narrow kind of superstition. The so-called superstition of religion was always wide enough to embrace both God and science. The superstition of science, it seems, cannot get beyond a slavish genuflection to itself. Religion never did more than to discipline science, Galileo’s house arrest being the worst case scenario. Scientism would like to annihilate religion, and its bishops of bombast (Freud, Dawkins, etc.) never lose an opportunity to predict with great relish the death of God.

This isn’t an accurate depiction of most scientists’ world views

They simply separate their work from their more philosophical inquiries and beliefs.

 

[larkin31]

Your earlier remarks already have their answers.

Yet now you are unwilling to admit you believe religion explains nothing! Why are you an agnostic? What is there left to explain?

I don’t understand the “Why” question. I am “agnostic” because I don’t categorically deny the existence of the supernatural. I mean exactly what the word means in this usage.

I don’t know all there is to know, so I don’t know what there is left to explain. There is much that is not known yet. I don’t see your point. I don’t argue against the existence of God. I am not interested in that.

 

[colmcille1]

CCATAGCACCTACCATGGAAACGACCATAACACCTACCTAAAGGGACG

What did I just say?

Can you say that in English?
Oh, sorry, I forgot, you don’t do English! How about Scots Gaelic? It’s fairly close to my Irish
and I would do my darnedest to accommodate the snakebends of your logic.

 

[tonyrey]

Your earlier remarks already have their answers.

I am not going to waste any more time or energy trying to elicit answers from a person who is unwilling to face the facts…

 

[JohnDamian]

Can you say that in English?
Oh, sorry, I forgot, you don’t do English! How about Scots Gaelic? It’s fairly close to my Irish
and I would do my darnedest to accommodate the snakebends of your logic.

Looth lewednesse leye unyolden thurgh your singe in deele I wene.

Is this Middelre Englisce close enough to your Irish for you to see the message? Ie; it is uncharitable to use languages other people might not understand. Moonstruck was merely using a language functional insofar as to demonstrate a particular point; not to be arrogant or condescending.

 

[Charlemagne_II]

*This isn’t an accurate depiction of most scientists’ world views

They simply separate their work from their more philosophical inquiries and beliefs. *

I was addressing not most scientists, but rather those who are victims of scientism; and they are mostly the atheists who believe that because they cannot find God by empirical means, He must not exist.

Foolishness of the highest sort.

 

[j1akey]

Behold the watchmaker argument!

Seriously check it out. Funny

 

[Charlemagne_II]

I checked it out.

A nitwit wasting time.

 

[wanstronian]

Outside of who did it can we agree on the red?

The only thing we can be sure of is that Genesis references phenomena that we know exist. We cannot conclude that Genesis is a record of the origin of those phenomena.

 

[rvilbig]

The only thing we can be sure of is that Genesis references phenomena that we know exist. We cannot conclude that Genesis is a record of the origin of those phenomena.

Saint Augustine taught us that Genesis is not a record of the historical origin of life in the universe, based on the obvious clues left in the text itself:

“[W]e recall the order in which things were fashioned, and find that the greenery of the field was created on the third day, before the sun was made on the fourth day, the sun which regulates by its presence this everyday normal day were are used to. So …] we are being admonished to turn our thoughts to that special day we should be striving the track down with our minds, …] a spiritual day in the harmonious unity of the angels’ mutual companionship, is certainly not such as the one we are familiar with here.” (Literal Meaning of Genesis, p. 278.)

So there’s hardly a tradition in the Church for believing that scientific research would confirm the Genesis account. It wasn’t intended in that sense. Saint Augustine teaches, on the contrary, that God created all things simultaneously (cf Sir 18:1) and that at the beginning all life was “produced potentially in their causes, before they could evolve through intervals of time, as they are now known to us in the works on which God is continuing to work until now (Jn 5:17)” (ibid. p.300).

So how are we to understand Genesis 1? Augustine argues that it is an allegorical prophesy of salvation history:

“For what I see throughout the whole tapestry of the divine scriptures is some six working ages, distinguished from each other by definite border posts, so to say, pointing in hope to rest on a seventh age; and I see these six ages as being like those six days in which the things were made which scripture describes God as making.” (Against the Manichees, p.62)

He goes on to explain that the six days are manifest in the six ages of salvation history, with the first age from Adam to Noah (light), the second age from Noah to Abraham (water separation), the third age from Abraham to David (plants), the fourth age from David to the Babylonian exile (great lights), the fifth age from the exile to the birth of Christ (aquatic and avian life). The sixth age then begins as follows:

“Morning …] is made from the preaching of the Gospel by our Lord Jesus Christ, and thus the fifth day is brought to an end; now begins the sixth in which the old man (Eph 4:22, Col 3:9) becomes evident. …] In this age, however, as in the old age of a very old man, the new man (Eph 4:24; Col 3:10) is born, who is already living according the spirit.” (ibid. p.63-4)

When you study what the Church has actually taught, you find a much richer theology than what has been conveyed in the secular media. Hope this was helpful/interesting,

-Ryan Vilbig
ryan.vilbig@gmail.com

 

[colmcille1]

Looth lewednesse leye unyolden thurgh your singe in deele I wene.

Is this Middelre Englisce close enough to your Irish for you to see the message? Ie; it is uncharitable to use languages other people might not understand. Moonstruck was merely using a language functional insofar as to demonstrate a particular point; not to be arrogant or condescending.

Now now, careful sir! Else you too, God forbid, may be tainted with the apparent atheistic stain of humourlessness! ‘Tis a condition to be avoided at all costs, sir!
(Ominous voiceover sfx: a whistling haunting wind)." Why those darned believers would fiendishly use that dreadful humour to trip you up and to trick you out of your atheistic comfort zone. Why I know of a fellow who to this day rubs his befuddled brow in a scourge of confusion."
(feeble Irish brogue)" Be the hokey, I didn’t know whither t’ laugh or cry…I always put me trust in atheism an’ shure now…now I’m rightly distracted…cos the fella on the web…he tried t’ make me laugh…LAUGH!..whass dat, I nivir heard o’ such a t’ing…(groans and mumbles into his mug of tea)
(Ominous v/o again with wind) BEWARE, fellow atheists! Laughter is lurking round every street corner, in every tavern, on buses, in offices, at the ball-game, laughter…laughter…LAUGHTER LAUGHTER LAUGHTER AAAAAAAARRRRGGGGHHH…).
(sfx:CRASH of symbols, saxophones squealing, drum-radid staccato…BOOM…Silence…
wind slowly creeps in once more…)
(Fade to atheistic black…)
God Bless

 

[j1akey]

Now now, careful sir! Else you too, God forbid, may be tainted with the apparent atheistic stain of humourlessness! ‘Tis a condition to be avoided at all costs, sir!
(Ominous voiceover sfx: a whistling haunting wind)." Why those darned believers would fiendishly use that dreadful humour to trip you up and to trick you out of your atheistic comfort zone. Why I know of a fellow who to this day rubs his befuddled brow in a scourge of confusion."
(feeble Irish brogue)" Be the hokey, I didn’t know whither t’ laugh or cry…I always put me trust in atheism an’ shure now…now I’m rightly distracted…cos the fella on the web…he tried t’ make me laugh…LAUGH!..whass dat, I nivir heard o’ such a t’ing…(groans and mumbles into his mug of tea)
(Ominous v/o again with wind) BEWARE, fellow atheists! Laughter is lurking round every street corner, in every tavern, on buses, in offices, at the ball-game, laughter…laughter…LAUGHTER LAUGHTER LAUGHTER AAAAAAAARRRRGGGGHHH…).
(sfx:CRASH of symbols, saxophones squealing, drum-radid staccato…BOOM…Silence…
wind slowly creeps in once more…)
(Fade to atheistic black…)
God Bless

uhhhh…wtf?

 

[Charlemagne_II]

Carl Sagan was another one of those who fell victim to scientism. When asked why he was an atheist, he replied that he never found a compelling reason to believe in God. What would he have accepted as a compelling reason? That God would show himself personally to Carl Sagan? But then if Sagan had a God experience, wouldn’t Sagan have reasoned that he was himself delusional? You see, with scientism there can be no compelling reason to believe in anything outside the scientific venue, not because there is no compelling reason to believe, but because one is compelled from within not to find a compelling reason. Scientism becomes a curtain the atheist has pulled over his intellect to blind it from seeing (or even searching for) compelling reasons that have nothing to do with science.

Francis Collins, former leader of the Human Genome Project, has recently described his youthful adoption of atheism as one of “willful blindness.”

 

[wanstronian]

Perhaps we are misunderstanding each other.

Are you claiming saltations here?

Not in the slightest, I’m just amazed that you appear to think evolutionary theory proposes the development of individual features in isolation.

It’s becoming clear that when you stated you had read up on evolution, what you actually read were creationist misrepresentations of it.

You seem to still be hinging your belief in Design on the long-debunked hypothesis of irreducible complexity.

So now you seem to subscribe to three conflicting viewpoints:

Firstly, you think that Genesis is an accurate record of events - which means you believe Special Creation.
Secondly, your sig line indicates that you believe an intelligent designer created DNA, then evolution took over.
Thirdly, you seem to believe that irreducible complexity is still a valid objection to evolution. This implies that you think entire organisms were designed in their entirety, to overcome the alleged problem of irreducible complexity.

Just what do you believe?

 

[Charlemagne_II]

So tell us, Wanstronian, how did the first living cell come to be … when there was nothing for it to evolve from?

Did it come about by chance, or by design, or by some other method?

 

[larkin31]

So tell us, Wanstronian, how did the first living cell come to be … when there was nothing for it to evolve from?

Did it come about by chance, or by design, or by some other method?

abiogenesis is a very young and speculative science, for obvious reasons

here is the wiki summary of several tentative theories and a few links to the small amount of associated research done: en.wikipedia.org/wiki/Abiogenesis

it’s a long entry. Enjoy!

for supernatural or extraterrestrial theories, seek elsewhere…

 

[Charlemagne_II]

larkin

abiogenesis is a very young and speculative science, for obvious reasons

But what cannot be said about it is that it fits into the theory of evolution, not by a long shot.

Atheistic scientists will be looking with all their might for an explanation that avoids design, just as Einstein looked with all his might for a way to avoid any semblance of a created universe.

 

[larkin31]

larkin

abiogenesis is a very young and speculative science, for obvious reasons

But what cannot be said about it is that it fits into the theory of evolution, not by a long shot.

Atheistic scientists will be looking with all their might for an explanation that avoids design, just as Einstein looked with all his might for a way to avoid any semblance of a created universe.

Did you read any of the page I linked?