Is intelligent design a plausible theory?

[reggieM]

biblegateway.com/passage/?search=Exodus%2015:8,

You might consider using the Douay or other Catholic versions – unless your point is that you want to argue against shoddy translations?

Exodus 15:8 And with the blast of thy anger the waters were gathered together: the flowing water stood, the depths were gathered together in the midst of the sea.

 

[liquidpele]

You might consider using the Douay or other Catholic versions – unless your point is that you want to argue against shoddy translations?

Exodus 15:8 And with the blast of thy anger the waters were gathered together: the flowing water stood, the depths were gathered together in the midst of the sea.

I was just pointing out where he got the nostril thing from. Now wouldn’t it be funny if you replaced “anger” with “flatulence” there!

 

[StAnastasia]

I was just pointing out where he got the nostril thing from. Now wouldn’t it be funny if you replaced “anger” with “flatulence” there!

That’s for thunder

 

[tonyrey]

It seems obvious to me that there is a physical component to intelligence, just as there is a physical component to being human. Evolution can help explain the origin of that physical component.

                                                                                                  Part 1

It now seems appropriate to summarize our views and put the points we are discussing in a more logical order.

In the context of the OP there are three possible views:

1. There is Design with a Designer (which is my view).
2. There is Design without a Designer (which is your view, I think).
3. There is no Design.

I believe Design presupposes Intelligence because design presupposes intelligence. Without hindsight, insight and foresight how can there be design in the full sense of the term? (Monod used the terms “teleonomic” and “teleological” to evade this difficulty.)

You believe intelligence has two aspects: physical and non-physical. Yet mainstream scientists do not recognize this distinction.They believe NeoDarwinism gives a complete explanation of human beings. Psychologists study intelligence scientifically and attempt to explain mental activity as the result of neurological processes. Religious experience and decision-making, for example, are thought to be located in specific areas of the brain.

The onus is on you therefore to explain which aspects of intelligence are physical, which are non-physical and how they are related - with evidence to support your theory. The default scientific view is that intelligence is physical. So all explanations of intelligent activity are scientific if they satisfy the criteria of scientific explanations. Since psychology has made important contributions to our understanding of intelligence it should not be regarded as non-scientific. It re-affirms our belief that intelligent activity presupposes intelligence and design necessitates a designer.

The default position of science is not “we don’t know” but the best available scientific explanation. We are not justified in believing human beings are the only intelligent beings. We are justified therefore in extrapolating from the evidence of human design to the possibility of non-human Design. The simplest and most economical explanation of non-human Design is a Designer - given that design cannot be designerless.

Design is a far more **adequate **explanation of:

1. The origin of the orderly universe than the speculative hypotheses offered by some scientists
2. The immense **value **of life than the hypothesis that it is due to random combinations of molecules and unexplained physical laws.
3. The directiveness of evolution than the hypothesis that it is due to random mutatations of molecules and natural selection.

The only evidence we have of directed activity is designed activity.

Intelligent design need not entail the movement of molecules nor any movement at all. A mathematical or artistic or personal project need not be implemented physically. The DNA code is an example of a mathematical design that has been implemented. Its origin has not been explained by science. The best available explanation is Design.

Part 2 will examine the other criteria of a scientific explanation and will be presented this evening.

 

[rossum]

Part 1

It now seems appropriate to summarize our views and put the points we are discussing in a more logical order.

In the context of the OP there are three possible views:

1. There is Design with a Designer (which is my view).
2. There is Design without a Designer (which is your view, I think).
3. There is no Design.

1. There is the appearance of Design, without a designer. Which is my view, but is slightly different from your #2.

I believe Design presupposes Intelligence because design presupposes intelligence.

Design does presuppose intelligence. The mere appearance of design does not.

You believe intelligence has two aspects: physical and non-physical. Yet mainstream scientists do not recognize this distinction.

Some scientists do. Any theist scientist would, like Theodosius Dobzhansky, Abdus Salam, Francis Collins, Ken Miller and many others. All of thoses are, or were, mainstream scientists.

They believe NeoDarwinism gives a complete explanation of human beings. Psychologists study intelligence scientifically and attempt to explain mental activity as the result of neurological processes.

I have no problem with scientists studying the material component of intelligence.

The onus is on you therefore to explain which aspects of intelligence are physical, which are non-physical and how they are related - with evidence to support your theory.

I have no theory, I merely have personal beliefs outside science. What I believe is not relevant to whether or not ID is plausible as science.

The default position of science is not “we don’t know” but the best available scientific explanation.

The best explanation may well be “we don’t know”. That is pretty much the current answer to the question of what came before the Big Bang in cosmology. There are a number of competing hypotheses, with no clear winner. The current answer is indeed “we don’t know”.

We are not justified in believing human beings are the only intelligent beings.

Philosophically I have no problem with that. Scientifically I disagree. There is no scientific evidence of non-human designers outside earth. There is no scientific evidence of non-human design apart from things like spiders’ webs etc from other living things on earth. ID claims that sush non-human design exists, but it has not shown enough supporting evidence for its claim to pass muster as science.

In scientific terms you cannot propose design unless you have scientific evidence for designer(s) also. It is also currently the case that ID has no tried and tested way of detecting design. Some ways have been proposed but they have not, to my knowledge, been subjected to proper scientific double-blind testing. That is an obvious early task for any ID labs.

Design is a far more **adequate **explanation of:

1. The origin of the orderly universe than the speculative hypotheses offered by some scientists

ID is free to take its place alongside all the other cosmological hypotheses and to provide scientific evidence to support its proposals. If it cannot provide scientific evidence, and predictions that allow it to be tested, then it will lose.

1. The immense **value **of life than the hypothesis that it is due to random combinations of molecules and unexplained physical laws.

Scientifically ID has very little value precisely because it can explain anything and everything. That makes it very difficult for ID to make predictions. Evolution can predict that we will never see a pegasus - a mammal with feathers. ID cannot make that prediction because it is possible for the ID designer(s) to design and manufacture a pegasus.

1. The directiveness of evolution than the hypothesis that it is due to random mutatations of molecules and natural selection.

Evolution follows and tracks the environment. If the environment has a direction then so will evolution. If the environment is static then evolution will also be static.

The only evidence we have of directed activity is designed activity.

But you have no evidence that evolution in particular is a directed activity. I go back to my point at the start of this post. The appearance of something may be deceptive. What looks like directed activity can in fact be undirected in the sense in which you are talking.

Intelligent design need not entail the movement of molecules nor any movement at all. A mathematical or artistic or personal project need not be implemented physically.

Here I disagree. Living organisms have been implemented physically. Hence ID has to explain the physical mechanisms used by the designer(s) for implementing their designs of living organisms. A non-implemented design cannot replace evolution in biology classes.

rossum

 

[tonyrey]

Part 2

1. What scientific experiment can I perform in the lab to show the action of the intelligent designer(s) proposed by the ID hypothesis?

You can devise and implement a method of torturing an animal to demonstrate your free will - which can be explained only by the sustaining power of the Designer.

(Q 51) What observation can I make in the field to show the action of the intelligent designer(s) proposed by the ID hypothesis?

I have pointed out that the exquisite beauty of nature is explained by a creative Designer - and not by forces which lack both intelligence and aesthetic appreciation. King Solomon in all his glory was not arrayed like the lilies of the field…

(Q 52) How could the Intelligent Design hypothesis be falsified?

The Intelligent Design explanation would be falsified if it were shown to be:
(a) unintelligible. You yourself have argued the concepts of Design and a Designer are unintelligible.
(b) inconsistent. Atheists have often attempted to falsify Design by referring to the evil and suffering in the world.
(b) incoherent. According to Design the laws of nature are designed as a basis for life, development and rational existence. If those laws ceased to hold good it would demonstrate that the very foundations of Design have been removed.
(c).superfluous. Design claims that human beings free will and responsibility were designed. If neurological research showed that free will and responsibility are illusions Design would be falsified.
(d) uneconomical. If NeoDarwinism explained the existence of human beings it would refute Design by making it superfluous since Design postulates a Designer whereas NeoDarwinism does not. The immense value of life implies that the Designer is good and would not resort to the subterfuge of mimicry.
(e) improbable. If science disposed of immaterial entities by showing they have a physical explanation Design would be refuted. If there were overwhelming evidence for materialism the concept of a Designer would no longer be tenable.

 

[rossum]

(Q 50) You can devise and implement a method of torturing an animal to demonstrate your free will - which can be explained only by the sustaining power of the Designer.

No. You first need to show that the existence of free will (on which there is still a great deal of philosophical disagreement) has been scientifically shown to require the existence of a designer. You assert that it does, but you have not shown it to the required standard of scientific evidence.

(Q 51) I have pointed out that the exquisite beauty of nature is explained by a creative Designer - and not by forces which lack both intelligence and aesthetic appreciation.

Thankyou for disproving the existence of a designer. Given that ugliness exists in nature then the existence of your designer is disproved. We can safely conclude that no designer exists and hence that Intelligent Design is not plausible. How can it be plausible if there is no designer?

(Q 52) How could the Intelligent Design hypothesis be falsified?

The Intelligent Design explanation would be falsified if it were shown to be:
(a) unintelligible. You yourself have argued the concepts of Design and a Designer are unintelligible.

I have argued that design by a non-existent designer is unintelligible. I have yet to see any scientific evidence of the existence of the designer proposed by ID. Human design is of course intelligible.

(b) inconsistent. Atheists have often attempted to falsify Design by referring to the evil and suffering in the world.

Yet you just tried to use the existence of beauty as a evidence of a designer. If you are allowed to use beauty as an argument for the designer, then why cannot others use ugliness as an argument against the designer? If the designer explains both ugliness and beauty then neither can be used as a falsification.

(b) incoherent. According to Design the laws of nature are designed as a basis for life, development and rational existence. If those laws ceased to hold good it would demonstrate that the very foundations of Design have been removed.
(c).superfluous. Design claims that human beings free will and responsibility were designed. If neurological research showed that free will and responsibility are illusions Design would be falsified.

You have failed to show that design is the only possible explanation. You assert that it is but provide no scientific evidence. If other explanations were possible then these are not falsifications of design. You also have the problem of a designer who mimics non-design processes.

(d) uneconomical. If NeoDarwinism explained the existence of human beings it would refute Design by making it superfluous since Design postulates a Designer whereas NeoDarwinism does not. The immense value of life implies that the Designer is good and would not resort to the subterfuge of mimicry.

You are asserting that the designer is “good”. The standard designer of ID is not asserted to be good. Professor Behe holds up the malaria parasite as an example of design. I do not think that malaria is “good”. The DI spends a lot of time claiming that the ID is not creationism and the the designer is not the Abrahamic God. The “good” attribute belongs to the Abrahamic God, not to the ID designer.

(e) improbable. If science disposed of immaterial entities by showing they have a physical explanation Design would be refuted. If there were overwhelming evidence for materialism the concept of a Designer would no longer be tenable.

Again you have the problem of a designer who mimics non-design processes. This point cannot falsify such a designer.

rossum

 

[tonyrey]

1. There is the appearance of Design, without a designer.

“A purpose, an intention, or design strikes everywhere the most careless, the most stupid thinker; and no man can be so hardened in absurd systems, as at all times to reject it… hat the works of Nature bear a great analogy to the productions of art is evident: and according to all the rules of good reasoning, we ought to infer … that their causes have a proportional analogy.” (David Hume)

Since you admit there is an appearance of Design it must be the best available explanation - if it produces scientific evidence. And if Design is the best available explanation the only explanation of Design is an Intelligence because, as you agree, design presupposes intelligence.

Since you cannot distinguish the physical and non-physical aspects of intelligence and have no problem with scientists studying the material component of intelligence it is unreasonable to regard intelligent design as unscientific. Why should one aspect of intelligence be unscientific and the other non-scientific when psychology studies the phenomenon of intelligence as a whole? How could you delineate the two aspects? There is no clear borderline between them.

There are a number of competing hypotheses in cosmology with no clear winner but there are only three hypotheses about the origin of intelligent beings:

1. Instant Creation.
2. Undesigned evolution.
3. Designed evolution - which is the clear winner because it is the only adequate explanation of intelligent, purposeful beings.

There is scientific evidence of Design because the physical laws which enable intelligent beings to exist on this planet are universal. The immense time scale and vast size of the universe make it highly improbable that intelligent beings do not exist elsewhere in the universe. Even if none exist it does not follow that there is no scientific evidence on this planet. The fact that there are intelligent beings here is sufficient scientific evidence for the existence of an intelligent Being. As David Hume noted, the cause must be proportioned to the effect.

Since there cannot be design without intelligence scientific evidence for Design constitutes scientific evidence for a Intelligent Designer.

One tried and tested way of detecting design is to examine instances of human behaviour to see whether they are rational and purposeful. In the law courts there are definite criteria for determining whether actions are premeditated. SETI is another example.

Design is a far more adequate explanation of the origin of the universe than speculative cosmologies which ignore the problem of the origin of intelligent beings.

Despite your allegation Design cannot explain everything. For example, it cannot explain the nature and existence of the Designer. It cannot explain the exact proportion of Designed and undesigned events because the scope of the element of chance is difficult to determine but it maintains that the framework of order in the universe and the salient features of evolution are designed. It predicts that the laws of nature will continue to hold good, that robots will never be held responsible for their activity or have the right to exist and that the human mind will never be explained solely by neurological processes.

The Design of living organisms has been implemented physically by the Creation of the universe with its physical laws and physical mechanisms, e.g. the information system contained in the DNA code. It is no accident that the precise values of physical constants and chemical constituents have occurred out of an inestimable number of possibilities.

The directiveness of evolution is evident in the development of monocellular organisms to intelligent beings. By any standards this is evidence of a clearly defined progression. Monod who believed evolution is due to chance and necessity refers to the “general **upward **course of evolution”. Even mechanistic explanation of the functions of one living cell is now recognized by many biologists as an inadequate approach that must be supplemented by the concept of goal-directed activity.

 

[rossum]

Since you admit there is an appearance of Design it must be the best available explanation - if it produces scientific evidence.

if there is an appearance of design, then the best explanation is that there is an appearance of design, nothing more than that. The deeper explanation may be that there is actually no design - as with snowflakes or pulsars - or that there is design - as with Mount Rushmore.

And if Design is the best available explanation the only explanation of Design is an Intelligence because, as you agree, design presupposes intelligence.

Given your “if” then yes. The mere appearance of design is not enough to trigger your “if”. More evidence is required than just appearance. One of the current failings of ID is that it has no relible and tested way to progress from “this appears to be designed” to “this is designed” reliably.

Since you cannot distinguish the physical and non-physical aspects of intelligence and have no problem with scientists studying the material component of intelligence it is unreasonable to regard intelligent design as unscientific.

I do not regard intelligent design per se as unscientific. The version of ID promoted by the Discovery Institute does not currently meet the required standard. There is no reason in principle why it may not meet that standard in future. There are already areas of science, such as forensic science and archaeology which use intellegent design as part of their methodology.

There are a number of competing hypotheses in cosmology with no clear winner but there are only three hypotheses about the origin of intelligent beings:

1. *]Instant Creation.
   *]Undesigned evolution.
   *]Designed evolution - which is the clear winner because it is the only adequate explanation of intelligent, purposeful beings.

1. 1. We do not know.
   2. Loki/Trickster messed up the evidence so we cannot tell what happened.
   3. A designer making it look like #2 but actually it is designed to look undesigned.
      I will only accept 3 as a scientific hypothesis is you can produce scientific evidence of your proposed designer/s. ID is not a plausible scientific hypothesis without plausible scientific evidence of the existence of the designer/s and of their actions.

   There is scientific evidence of Design because the physical laws which enable intelligent beings to exist on this planet are universal.

   What does that have to do with design? You are talking more about cosmology here. We do know that some physical laws have remained constant for the last 4.5 billion years since the earth formed. How is that indicative of design?
   

   The fact that there are intelligent beings here is sufficient scientific evidence for the existence of an intelligent Being.

   No. I reject your capitalised “Being”. The probable existence of intelligent beings elsewhere in the universe is what drives the SETI project. As soon as you start capitalising “Being” you are moving away from science and into theology. I have already said that I have no problem with classing ID as either theology or philosophy. It is the attempt to class it as science that is the problem.
   

   Since there cannot be design without intelligence scientific evidence for Design constitutes scientific evidence for a Intelligent Designer.

   If only there were such scientific evidence then ID would not be having its current problems getting into science classrooms. It is precisely the lack of any evidence beyond more sophisticated versions of “it sure looks designed to me” that is the problem. As I said at the start, ID has problems moving from the appearance of design to actual design. Mere appearance is not enough to sustain ID in the scientific world.
   

   Despite your allegation Design cannot explain everything. For example, it cannot explain the nature and existence of the Designer.

   I disagree, it requires the existence of the designer. Without the designer there is no design and hence no ID.
   
   rossum

 

[tonyrey]

If free will did not exist we would not be responsible for our behaviour. We would have no control over our behaviour. Yet every law court works on the assumption that we are responsible for our behaviour. As Kant pointed out “ought” implies “can”. Not only that. Science itself presupposes that we are rational beings. Without free will we would be incapable of being rational. Our decisions would be based on previous events. The truth makes us free but we have to be free to arrive at the truth! Our reasoning would be unreliable if it is the product of cerebral events over which we have no control.

The best available explanation of free will is that it originates in a rational Designer.

Thank you for proving that Design is in principle falsifiable. Your attempt to falsify Design and a Designer fails because the existence of ugliness does not disprove the existence of beauty. It merely proves we require an explanation of ugliness.

I have argued that design by a non-existent designer is unintelligible.

You have not proved the Design or the Designer do not exist. The evidence for Design requires explanation because it is prima facie evidence for Design and hence a Designer. As yet there is no other satisfactory explanation of the beauty in the world - or in art and mathematics for that matter.

If you are allowed to use beauty as an argument for the designer, then why cannot others use ugliness as an argument against the designer? If the designer explains both ugliness and beauty then neither can be used as a falsification.

The Designer is not used to explain ugliness. Ugliness is the result of the element of chance and imperfection which are inevitable in a finite world.

You have failed to show that design is the only possible explanation.

It is unnecessary to show that design is the only possible explanation. The onus is on you to produce a** better** explanation rather than appealing to ignorance.

You also have the problem of a designer who mimics non-design processes.

I have already pointed out that the immense value of life undermines the hypothesis that the Designer would resort to deception. Nor have you suggested any motive for mimicry because it would obviously be ludicrous.

I do not think that malaria is “good”.

Neither do I. I pointed out that there is an element of chance in evolution - which is to be expected where there are random mutations. There is no reason why development should always entail beneficial results.

Again you have the problem of a designer who mimics non-design processes.

That hypothesis has already been refuted.

 

[Charlemagne_II]

Any discussion of intelligent design must take into account that the design began at the first moment of creation. Had a slightly different universe exploded into being, there would be no possibility of life. All the elements and forces at work, from the creation of light to the emergence of stars and planets, followed an evolutionary pattern that, had it varied slightly again, would have made life impossible. And finally, when the great drama began on this planet, a thousand and more variables had to be in place and finely tuned before that mixing of atoms and molecules could produce the first sign of life. Yet again, another great journey begins, in which life, at first unconscious of itself, wends its way through another million species, each successively preparing the way for the present triumph of Man. The final creature looks back on his trip from the start of time and sees not a senseless and random progression without purpose, but a vast canvas upon which God has painted creation, all the while fine tuning the music of the spheres. As C.S. Lewis tersely put it: “All that is made seems planless to the darkened mind, because there are more plans than it looked for.” The theists will find in Mozart the glory of God beautifully and harmonically trumpeted. The atheists will find in their fellow atheist Shostakovich the dissonant ugliness of a universe without purpose. As the great philosopher said, “You pays your money and you takes your choice.”

 

[antonivs]

I believe in Evolution because I think the scientific evidence points in that direction. I also believe that God is ultimately responsible for our Universe and the life that has developed on it, as a part of my faith.

 That said,  I think "Intelligent Design" has a very long way to go before it can be called a plausible theory limited as we are by the Scientific Method.  Currently most of the arguments I have seen for ID consist of pointing out things that cannot currently be explained, i.e. arguing from ignorance.  We cannot explain it, ergo it must have been God.  I find these to be quite lacking.  

 I think that ID is being pushed by those whose faith feels threatened as science is able to explain more and more about our origins.  They need to keep in mind that the Scientific Method is limited and is not really set up to test the supernatural.  

 To me it is a truly wondrous God who can create the universe and multitude of complex life on our planet and possibly elsewhere by purely natural processes.  I find it miraculous and no threat to my faith in the least.  On the  contrary, I am awestruck by it.

 So, I am kind of a fish out of water.  I believe in God as our Creator, but don't believe ID as it currently stands is good science.  To those who take offense at anything I have written, please forgive my ignorance.  Peace and blessings to all on both sides of the debate.

 

[Charlemagne_II]

*I think that ID is being pushed by those whose faith feels threatened as science is able to explain more and more about our origins. They need to keep in mind that the Scientific Method is limited and is not really set up to test the supernatural. *

Nor is it set up to deny the supernatural.

Both Darwin and Einstein, who were without our faith, did believe in something approximating intelligent design. They could not have been threatened by the loss of faith. Their conclusions were sincere and justified. So are the convictions of those of faith who believe that ID makes more sense than blind accidents one after another since the Big Bang. It is certainly a truism to say that we solve intellectual riddles by the preponderance of evidence. There is no scientific evidence for blind abiogenesis and there never will be. The lack of scientific evidence points against the hypothesis of blind abiogenesis, not for it. In the absence of any other solution, if the universe seems to follow a long range plan culminating in the thing that can understand intelligent design because it practices it, it seems plausible, if not absolutely proven on a scientific level (what ever is absolutely proven on that level?) that we can reason backward to intelligent design.

I know this is painful to hear for those currently in the scientific arena, but it was not at one time, as the quotes below testify. Science, as you say, “is not set up to test the supernatural.” But it should not blindly reject evidence of that which is visible even among scientists who practice and apply it daily in their laboratories: namely, intelligent design.

“My religiosity consists of a humble admiration of the infinitely superior spirit who reveals himself in the slight details we are able to perceive with our frail and feeble minds. That deeply emotional conviction of the presence of a superior reasoning power, which is revealed in the incomprehensible universe, forms my idea of God.” Albert Einstein

“[Reason tells me of the] extreme difficulty or rather impossibility of conceiving this immense and wonderful universe, including man with his capability of looking far backwards and far into futurity, as the result of blind chance or necessity. When thus reflecting, I feel compelled to look to a First Cause having an intelligent mind in some degree analogous to that of man; and I deserve to be called a Theist.” from The Autobiography of Charles Darwin.

 

[Charlemagne_II]

*Currently most of the arguments I have seen for ID consist of pointing out things that cannot currently be explained, i.e. arguing from ignorance. We cannot explain it, ergo it must have been God. I find these to be quite lacking. *

To the best of my knowledge, Dembski, Behe and others do not use God in their arguments. They talk about intelligent design. If the inference is to be made that the intelligent designer must be God, that inference can be made without the imprimatur of science.

Moreover, if evidence is not forthcoming, and if it appears that it never will be forthcoming, that is not an argument from ignorance. You can’t just assume that *all *problems are solvable by the scientific method. Abiogenesis is one of them. So is the Big Bang. Other mysteries of nature may be forever unsolvable.

As a Catholic, you know it is also true in theology that some truths of our faith will never be logically demonstrable, and that we must settle for something to say by plausible approximation or analogy. Science will always have the same problem.

 

[rossum]

The best available explanation of free will is that it originates in a rational Designer.

I disagree. Buddhism accepts the existence of free will and denies the existence of a designer. Even without that, you are making a God of the gaps argument. That is a very dangerous thing to do. Where there is a god fitted into a gap and science fills the gap, the god has nowhere to go. Thor used to explain thunder. When that gap was filled what happened to Thor?

Thank you for proving that Design is in principle falsifiable.

Archaeologists and forensic scientists falsify design all the time, by distinguishing between design and non-design. So far ID does not have a tested method of distinguishing between design and non-design. Without such a method ID cannot falsify design.

Your attempt to falsify Design and a Designer fails because the existence of ugliness does not disprove the existence of beauty. It merely proves we require an explanation of ugliness.

If design can explain both beauty and ugliness then it becomes useless as an explanation. By explaining everything it explains nothing.

You have not proved the Design or the Designer do not exist. The evidence for Design requires explanation because it is prima facie evidence for Design and hence a Designer.

There is as yet no scientific evidence for design. In the absence of scientific evidence for design, there is no scientific requirement for a designer. I have nothing to prove because ID has not yet met the standard for scientific proof of design. Behe’s IC failed because it was shown that IC systems can evolve - and Behe himself has now agreed that they can. Dembski’s CSI failed because it has been unable to pin down precisely what it means by “specified” and because of the problem of copying, rather than generating, information. Dembski calls this “apparent information”. It is also worth noting that the ID side has not yet published any results of double blind tests for CSI so that this proposed method is currently untested. At the very least they need to test their proposed method before making grandiose claims for what it can and cannot do.

As yet there is no other satisfactory explanation of the beauty in the world - or in art and mathematics for that matter.

Why are you looking to science for an explanation of beauty and ugliness? They are subjective and wholly dependent on human perceptions.

The Designer is not used to explain ugliness. Ugliness is the result of the element of chance and imperfection which are inevitable in a finite world.

And your scientific evidence for this statement is? Since beauty and ugliness is in the eye of the beholder, the same object can be both beautiful and ugly at the same time when seen by two different people.

It is unnecessary to show that design is the only possible explanation. The onus is on you to produce a** better** explanation rather than appealing to ignorance.

Not in science it is not. You are proposing the existence of design and a designer. It is up to you to show scientific evidence for your hypothesis. If you cannot show evidence then you will lose the scientific argument. That is why ID is currently not accepted as science - it has not produced anywhere near enough scientific evidence.

rossum

 

[Charlemagne_II]

rossum

It is so tedious to have to point out to you over and over that no lab experiment has ever produced abiogenesis without design. Your claim that ID has not met the scientific test is certainly not reasonable in the light of your not being able to meet the scientific test of abiogenesis without design.

So you see, without conclusive evidence on either side, the only alternative is to go with the most plausible theory … where the math directs … and it certainly isn’t for the likelihood of abiogenesis by accident.

The only way to argue against ID is to argue against intelligent design itself … a preposterous claim since we see intelligent design in our daily affairs all the time.

 

[Michaelo]

It is so tedious to have to point out to you over and over that no lab experiment has ever produced abiogenesis without design. Your claim that ID has not met the scientific test is certainly not reasonable in the light of your not being able to meet the scientific test of abiogenesis without design.

It is so tedious to have to point out to you over and over that you cannot invoke false dichotomy to support ID.

So you see, without conclusive evidence on either side, the only alternative is to go with the most plausible theory … where the math directs … and it certainly isn’t for the likelihood of abiogenesis by accident.

What’s the probability that various natural phenomena arose via ID? The improbability of abiogenesis occurring in no way substantiates ID.

 

[rossum]

It is so tedious to have to point out to you over and over that no lab experiment has ever produced abiogenesis without design.

All experiments are designed by scientists. This is neither new nor important. Meteorologists can design experiments to study how hurricanes form. Does that mean that all hurricanes are designed? Of course not, it just means that the experiments are designed to study an undesigned phenomenon.

No experiment has ever so far shown all of abiogenesis in the lab. Some experiments have shown some parts of abiogenesis. That is about as far as abiogenesis research has gone at the moment.

Your claim that ID has not met the scientific test is certainly not reasonable in the light of your not being able to meet the scientific test of abiogenesis without design.

We can show part of abiogenesis in the lab. So far ID has been able to show no design at all in the lab. At the moment abiogenesis is ahead in lab work. If you have an experiment showing the designer at work in the lab then please refer me to it.

So you see, without conclusive evidence on either side, the only alternative is to go with the most plausible theory … where the math directs … and it certainly isn’t for the likelihood of abiogenesis by accident.

If you have maths, then you must have a mathematical model and some calculations. Show your mathematical model and your calculations so we can discuss them. I can tell you in advance that if your mathematical model fails to include the non-random element of chemistry then I will reject it. Chemistry is not a random process, and any model of abiogenesis that does not include chemistry is grossly lacking.

My own calculations indicate that the mathematical likelihood of the existence of a designer is less than 1.8 x 10[sup]-3628942[/sup]. In order to be preferred over abiogenesis you would have to show that abiogenesis was less probable than that.

The only way to argue against ID is to argue against intelligent design itself … a preposterous claim since we see intelligent design in our daily affairs all the time.

I have no problem with design. I have problems with assertions of design in biological organisms with no scientific evidence to back them up.

For example, here are two pieces of RNAesigned: ACCCAUAUUAGUUGACGUAACGCCUAAAUUUCGUAGGAUGAAUCCAUCGGAAAUGAAGAC
Random : UCAAUGUACAUUCAGUUGCGUUUACUAGCCUACUACCACGAGCAAUUGGCGAUAAGCGGA
What scientific test does ID have that can reliably distinguish between designed and random RNA? If ID has no reliable way to tell design from either chance or regularity then it cannot claim any sort of scientific rigour.

rossum

 

[StAnastasia]

To me it is a truly wondrous God who can create the universe and multitude of complex life on our planet and possibly elsewhere by purely natural processes. I find it miraculous and no threat to my faith in the least. On the contrary, I am awestruck by it. So, I am kind of a fish out of water. I believe in God as our Creator, but don’t believe ID as it currently stands is good science. To those who take offense at anything I have written, please forgive my ignorance. Peace and blessings to all on both sides of the debate.

Antonivs, you are not a fish out of water at all, except perhaps on this forum. For a look at the broad spectrum of religious opinion in support of the evolutionary view you share, see “Voices for Evolution,” at http://ncseweb.org/voices.

StAnastasia

 

[reggieM]

… a new book, due next week will help to answer the OP’s question.

Signature in the Cell
by Stephen C. Meyer