We can simply start at the fossil record. Any paleontologist will admit we have few pieces.
Nope. There are zero fossils that never fossilized.
Why would you even ask that? You put a percentage on what we have and you can’t do that unless you know what the ultimate total is.
So far all tests of the EF have been done on human design. Extending the EF to non-human design may not be valid. Quite how we would get an agreed example of non-human design presents a problem for ID.
Designed: ACUCAUAUAUCCUAGAGAAAUGCCUAAAUUUCGUGAGACCAAAGUAUCGGUAACCAGGAU
Random : AUGUAUAAGUGGCCCUUUCCAGCUAAGAUUGCAGUGCUUAACACAACAAGAUUGAUCUUGWe do not always have full access to the causal history, nevertheless we can make reasonable assumptions about it. So far ID has failed in all of its attempts to show that certain organs, or organelles, could not have evolved. We do not know who Seth’s wife was, nevertheless we can reasonably infer her existence from the genealogies in Genesis. Unless we have some very strong evidence to the contrary we can reasonably assume that Seth fathered Enosh in the usual way. ID needs similarly strong evidence to overturn the reasonable assumption that evolution produced the whole variety of life on earth from simple beginnings about 4.5 billion years ago.
Snowflakes are a good example, and one where the known causal history is of crucial importance. Without a knowledge of their causal history it is possible that snowflakes, with their high degree of symmetry, would register as designed.
That requires a lot of work on the ID side to refine and develop the EF. I have not seen much development of it since Dembski first proposed it some years ago. There has been more recent work from the ID side on Behe’s IC than there has been on Dembski’s EF.
Unlikely, because you are asking for more detail than is available. We may well all be descended form Adam, but none of us can produce a precise genealogy, complete with birth certificates, proving our descent from Adam.
The claim was that “the theory of evolution” is far from complete. But at the same time there is “no conflict” with what has been observed. This suggests that we already have all of the fossils needed to complete the puzzle. There would be no “gaps” (I asked rossum to provide examples of the gaps that make evolutionary theory “far from complete” but you could do so also).
In other words, everything that has been observed in nature fits Darwinian theory perfectly. There would be no need to find any more fossils because we already know how all species evolved.
What are the “things that are not known” with regards to evolutionary theory?
No it does not.
There are plenty of questions out there regarding the details of evolution that we don’t have that scientists are still working on.
So far, we don’t have any evidence that doesn’t fit within the theory of evolution. We clearly know that all species evolve. The theory is about how that evolution has come about and is subject to change if we find evidence that doesn’t fit the theory. Therefore, the search continues.
What does it suggest then?
What are some of the “plenty of questions” regarding the theory of evolution that we don’t have answers for?
I can see that you don’t like the question and you’ve decided to counter-attack instead. That’s ok – I can understand why someone would not want to talk about the weaknesses, gaps, lack of knowledge, far-from-completeness, or “plenty of questions” regarding evolution. I can understand that you wouldn’t even want to mention one of the “plenty”. I’m not trying to put you on the spot. But why shouldn’t I catalogue all of the gaps in evolutionary theory?
Ok, according to you, everything we have ever observed in nature fits perfectly with Darwinian theory. There are no gaps and no conflicts with observations.
Yes, you seem to be saying that we have not found anything in nature that does not fit the theory.
We don’t have a clear evolutionary line of hominids. We can see from the evidence that humans have evolved from an earlier form and we have some of the pieces of the puzzle, but we don’t have all the peices.
So far that is correct.
Lack of information does not equate conflict. The nature of the gaps is, for example, fossils of every species that has ever lived. For example, it may turn out that we only have every third or so species in an evolutionary line. The fossils that we have fit in with what is predicted by the theory of evolution. The theory, with regards to that evolutionary line, is affirmed. That doesn’t mean that we will stop looking for other transitional species that may or may not exist because finding any other species in that lineage will only help give us a more complete understanding of the history of life on earth.
That we don’t have all the answers.
Hominids.
Good try, reggie. I am doing my best to avoid what you just did. I am trying to civily answer your questions. I am not counter attacking. I am not attacking at all. Please help yourself to your catalogueing of the gaps. Since we don’t know all possible gaps, you will be busy for a long time.
Really? I said there were no gaps? Hmm. I guess you have a very short memory since that is what you and I are CURRENTLY discussing.
That is correct.
You’re talking about gaps in knowledge (data) and I’m talking about gaps “in the theory”.
You’re talking about gaps in knowledge (data) and I’m talking about gaps “in the theory”.
Don’t push the analogy too far. The current theory explains all the data we have so far. There are gaps because we do not have all the data available. There are some invertebrate phyla for which there is no fossil record at all so we will have to rely entirely on DNA evidence, when we get round to sequencing tham all.
First off, not everything in nature is evaluated in light of evolution. Second, to my knowledge, there is no evidence that does not fit into the existing theory. Third, unexplained phenomena being explained by anything is kind of like a fossil that didn’t fossilize!
I am unaware of any evidence (observation) that contradicts the theory. Do you have any evidence that would contradict the theory?
Why do you feel that you need to inject, at the end of our post, materialism into the theory?
You made the bold statement that there was no evidence and that there is nothing in nature that is not perfectly explained by Darwinian theory. Now you’re saying that you’re “unaware” if there are any contradictions. What kind of certainty is that? You’re a scientist and you have never seen any evidence anywhere in observations of nature that does not fit Darwinian theory perfectly. Now you’re asking me to show you something. I was looking to you for answers. It’s a yes or no. You made an incredibly strong statement of certainty, but now it appears that you don’t know for sure. Have you not studied this enough to simply support your affirmation? You just need to sign on to the statement that there is nothing in nature that is not perfectly explained by Darwinian theory. There are no anomalies, no mysteries – everything we have ever observed in nature is explainable by Darwinian theory.First off, not everything in nature is evaluated in light of evolution. Second, to my knowledge, there is no evidence that does not fit into the existing theory. Third, unexplained phenomena being explained by anything is kind of like a fossil that didn’t fossilize!
What’s significant is the fact that one successfully predicts the other to a very high level of precision.
You should know the difference between a phenomenon not yet explained by a theory, and one that contradicts a theory. This one is the former, not the latter.
As you should know, Darwin’s great discovery was that evolution was not random. So that fits nicely into evolutionary theory.
Sigh. Here we go again. Reggie, if you have evidence that contradicts the theory, please present it. Otherwise, you are blowing smoke just as all creationists do.
I have never seen any evidence that contradicts the theory. Have you?
No, you weren’t. You are rehashing a conversation we have had before. You are looking for a gotcha moment because you don’t have any evidence that contradicts the theory of evolution.
I know of no evidence that contradicts the theory of evolution. Is that clear enough?
Are you really going to use that article to argue against the theory of evolution? Really?
Tim – I’m very sure you didn’t understand the article.
If we could just get you guys to realize that science endorses evolution, not because it is a good idea, but because the (E-word) shows that it’s true, it would be a major enlightenment.
The scientists that conducted the research disagree with you reggie. Ranting about my reading comprehension doesn’t change that fact.
That didn’t take too long. You have done this before. I challenge you to show anyone on these fora that I have ever taken a position contrary to the Church. EVER. If you cannot, I will expect an apology for your continued attack on my faith.
A big part of the problem, reggie, is that you are not a scientist yet you seem to think that you know more about science than scientists do. The two scientists who did this research know more about this than you do. They used language to let the rest of the scientific world know what they found (by the way, we are discussing a webpage article, not the scientists’ paper). You may think that they are trying to put up smoke screens to keep the truth from coming out, but they were very clear about their findings. You just don’t want to hear what they said. Obviously.