Homo- Sexuality

[Thorolfr]

MiserereMeiDei:

They did it to avoid calling them sodomites since sodomy is the crime they say they have to commit and no one was going to fall for “love is love” when they talked about sodomy.

Did you mean ‘crime’ or sin?

If “sodomy” is a crime, then when someone uses the word “sodomite,” that must mean that they consider the people to whom they are referring to be criminals.

 

[MiserereMeiDei]

Words derived from Christendom disimbuing them of neutrality is such a low bar for this complaint one can hardly imagine such a complaint arising. Well, I did say it is a crime. I’m not convinced of it’s lack of neutrality because of its source as it simply describes a criminal act, just as adultery describes the crime of the adulterer. I can imagine the adulterer feeling similarly in the days when he would be punished for his crime, though none would have cared for his feelings on the matter, and so he’d never bother to protest. If the attachment of criminality to the word robs it of its neutrality in your mind, that’s really of no consequence and I don’t think it’s reasonable. You are free to think otherwise, of course. It seems the Distinguished Professor is very convincing to you. Very comforting, but of no import.

medieval prurient confusion

Oh deary me! lol

the eleventh century theologian Peter Damian

I have St. Peter Damian’s The Book of Gomorrah, but I haven’t read it yet, thank you for the reminder.

 

[MiserereMeiDei]

It needn’t be a conspiracy to be deliberate. And I already said to on_the_hill that it may have been perceived as adding clarity, though in actuality it does not and, in fact, is not even a matter of relevancy. Any person attracted to one to whom they are forbidden suffers the same problem be they attracted to a member of the same sex, a married person or a priest or nun.

 

[halogirl]

OP I pray for your dear niece xx

 

[boldlygo]

The only people overly concerned about whether the children of gay parents turn out gay are those people who think that it’s a bad thing to be gay

Homosexuals are four times as likely to commit suicide, four times as likely to have problems with alcohol, and twice as likely to have problems with drugs…I wouldn’t wish that on any child.

. It’s obvious that gay parenting is not an important thing to consider in trying to determine what causes someone to be gay.

If your adopted child became a drug addict, [or worse…] you might not say that…

 

[Thorolfr]

Thorolfr:

The only people overly concerned about whether the children of gay parents turn out gay are those people who think that it’s a bad thing to be gay

Homosexuals are four times as likely to commit suicide, four times as likely to have problems with alcohol, and twice as likely to have problems with drugs…I wouldn’t wish that on any child.

That’s what happens to people who are disowned or feel excluded by their families, grow up feeling that God must hate them and that they are seriously defective, are bullied by other kids at school, have no positive role models growing up, are discriminated against or fear being discriminated against in their work, etc. Cumulatively, things like that tend to damage LGBT people’s self esteem and their mental health which can make them more prone to substance abuse and suicide. But hopefully this will be less of a problem now that LGBT people have achieved more acceptance in society and are growing up feeling more positive about themselves.

And now LGBT young people have positive role models like Tim Cook, the CEO of Apple or Pete Buttigieg, a combat veteran, Harvard graduate, former mayor and now a candidate for President of the United States, or the computer scientist and code breaker Alan Turing who will be on the 50 pound banknote.

 

[boldlygo]

That’s what happens to people who are disowned or feel excluded by their families, grow up feeling that God must hate them and that they are seriously defective, are bullied by other kids at school, have no positive role models growing up, are discriminated against or fear being discriminated against in their work, etc. Cumulatively, things like that tend to damage LGBT people’s self esteem and their mental health which can make them more prone to substance abuse and suicide.

We’ve had this discussion before, maybe more than once…I’ve stated facts, and you’ve answered with speculation. For the sake of all the lives involved, I hope and pray you’re right, but would you model this lifestyle to an adopted child based on mere speculation?

 

[VanitasVanitatum]

Obviously, you skipped [or chose to ignore] footnote ‘7’…data taken from pro-homosexual sources which supports the assertion that children raised by same-sex parents are many times more likely to be non-heterosexual than those raised by biological parents.
You’re going after the messenger, and ignoring the message.

Is there any evidence besides that assertion?

 

[boldlygo]

Assertion??!!

 

[VanitasVanitatum]

Well, he could have been lying so evidence is vital to the argument.

 

[Thorolfr]

We’ve had this discussion before, maybe more than once…I’ve stated facts, and you’ve answered with speculation. For the sake of all the lives involved, I hope and pray you’re right, but would you model this lifestyle to an adopted child based on mere speculation?

It’s not all just idle speculation on my part. I’m a gay man who knows what it’s like to grow up gay. I’ve also been out and have been involved to varying degrees with the gay community and a lot of other gay people for almost 40 years. Because of all that, I have a lot of life experience that gives me a better understanding of many of these things than someone like Mr. Dent. There is no “gay lifestyle”. I know all sorts of different kinds of gay people and their lives are not all the same. I know some who go to church every Sunday and I know some who are pastors of churches. The pastor of the Lutheran church I attend is a gay man. I know some who have been excellent parents. There are some gay people like Tim Cook who have been very successful businessmen. I doubt that he has been living the imaginary “gay lifestyle” involving drugs and alcohol and multiple sexual partners that some people imagine all gay people must be living. There are plenty of gay people who have never attempted suicide, don’t abuse drugs or alcohol and are in long term relationships. My partner and I have been in a monogamous relationship for more than 20 years.

 

[Bradskii]

Not all homosexuals are sodomites and not all sodomites are homosexuals (I assume by homosexual you mean SSA) but all sodomites are committing a grave sin. Calling a spade a spade isn’t disrespectful. Sodomy is an act and the one who willingly carries out that act is a sodomite. To whom one is attracted isn’t relevant.

Not all Christians use terms which are derogatory and insensitive in order to make a point. And not all people who use those terms are Christian.

But there do seem to be so many of you.

Let me put it this way. If we were in a bar and you referred to my niece as a sodomite, then what you wouldn’t getand what you shouldn’t expect would be a polite post in response.

 

[casslean]

Homosexuals are four times as likely to commit suicide, four times as likely to have problems with alcohol, and twice as likely to have problems with drugs…I wouldn’t wish that on any child.

Those problems don’t arise in a vacuum. The mental health difficulties homosexual individuals face are caused in a very large part by the discrimination and frankly hatred that they face every day for something they did not choose and cannot change.

So if you wouldn’t wish it on a child, stop acting in a way that will perpetuate it.

 

[on_the_hill]

There is no “gay lifestyle”.

I tried to refute your claim but can’t come up with any lifestyle examples that are exclusively gay. Except for the one part about being homosexual. And the affinity for Mazda Miatas.

 

[boldlygo]

So if you wouldn’t wish it on a child, stop acting in a way that will perpetuate it.

Boy, talk about taking things out of context!!
My point was that ‘those problems’ do exist, and there is only speculation as to their cause. Because of this, I would oppose adoption by same-sex parents to avoid putting the child at additional risk.

 

[boldlygo]

There is no “gay lifestyle”.

That’s why the Red Cross has questions about sex ‘with another male’ on their blood donor questionnaire…if you weren’t ‘at risk’, the Red Cross would be happy to take your blood.

 

[EndTimes]

Causes of Same Sex Attraction … are manifold… including conscious and subconscious Choice… That said, Genetic Determination of Behaviors is not only someone’s guess, it was virtually rejected by many once the Sequence of Human Genome was unfurled - roughly 2000 AD…, In spite of attempts to deny this following, no GENE has been shown which makes someone choose to have sex with someone or something other than their opposite-gender Husband and/or Wife

 

[Thorolfr]

Causes of Same Sex Attraction … are manifold… including conscious and subconscious Choice… That said, Genetic Determination of Behaviors is not only someone’s guess, it was virtually rejected by many once the Sequence of Human Genome was unfurled - roughly 2000 AD…, In spite of attempts to deny this following, no GENE has been shown which makes someone choose to have sex with someone or something other than their opposite-gender Husband and/or Wife

Sequencing the human genome did not prove that there are no genes that influence someone’s sexual orientation. All this did is tell us what the DNA sequence is for the individuals used to form a reference genome that other humans can be compared against. It is nothing more than a huge sequence about 3 billion units long of one of four possible nucleotides: cytosine ( C), guanine (G), adenine (A) or thymine (T). I had more than 10 million base pairs of my Y chromosome sequenced. One little section of one strand of my Y chromosome sequence reads like this:

CTGTACTGTACTATACTATACTATACTATACTATACTATACTATACTATACCATACTATACTATACTATACCATA

So, what does that tell us? It doesn’t tell us much since we have no idea what that sequence means or what it does if anything. The huge sequences in other chromosomes are similar to this. Some of them are known to contain genes, i.e. coding regions or sequences of nucleotides in DNA or RNA that code for molecules that have a function. Some DNA sequences, on the other hand, are called “junk DNA” because they don’t seem to do anything as far as we know. But we don’t know for sure because we don’t yet know what the function of many sequences is. And although genes might not determine people’s behaviors, many genes certainly influence their behaviors. And it’s rare for most behaviors or characteristics to be determined by one single gene. In most cases, there are probably multiple genes involved which interact with the environment and figuring out what those multiple genes are and how they interact is very complicated.

Just to give an example involving ADHD, something which I’ve studied a lot about, it has been shown that it is highly heritable. If someone has a parent or sibling or child with ADHD, they are much more likely to have ADHD themselves. But no single ADHD gene has been found. Genome wide scans have found some genes that might be associated with ADHD, but as one expert on the subject has stated, “yet even these associations are small and consistent with the idea that the genetic vulnerability to ADHD is mediated by many genes of small effect.”

It’s unlikely that a single “gay gene” will be found, but, someone’s “genetic vulnerability” to homosexuality might be “mediated by many genes of small effect.”

 

[EndTimes]

Evidences exist which support what I’ve said - including testimonies from ex-homosexuals

Yes Pre-2000AD the number of genes had been guesstimated to be far more than what they are. Genetic Behavior Determinism was popular until the Genome was revealed.
Then it quickly fell out of favor - and of course, later, to be expected, is resurrected by those whom seemingly Want LBGQetc to be true sub-variations of Humanity .

Proof? That’s another story…

POINT? There is no known genetic causation for SSA…

There are Known Causes of SSA… Including Choice and Nurture…

Official Church Teachings do not support Homosexuals as being born that way…

 

[Thorolfr]

One of the most interesting things revealed by the sequencing of the human genome and the subsequent sequencing of the Neanderthal genome and the genomes of other great apes is how we are genetically related to each other and share a common ancestor.

And as for there not yet being a fully understood or known genetic link to homosexuality, we also don’t yet fully know or understand the genetic links to many other human conditions or characteristics, but that doesn’t mean that no such links exist. We’re only at the beginning stage of unraveling how our DNA works. And then there’s also epigenetics, which makes everything even more complicated.

And as far as I know, “Official Church Teachings” don’t have anything to say about whether Homosexuals are born that way. The Catechism says that “its psychological genesis remains largely unexplained.”