Virologist whistleblower says COVID-19 was intentionally created in Chinese lab

  • Thread starter Thread starter Cathoholic
  • Start date Start date
Status
Not open for further replies.
So, bringing it back to the Gospel, Jesus was tortured and murdered by a large group of people. What He recognized was that the crowd did not know what they were doing. Stalin obviously saw his son-in-law as a threat or something of negative value, as the crowd did of Jesus.

Can you relate to the crowd? Can you see that we are all like Stalin, all capable of such blindness?
No. I do not see us all like Stalin, other than what I quoted earlier. I’m not willing to evaluate Stalin’s act in a salvation sense. That’s above my pay grade. Do I pray for grace for him? Yes. But his actions here on earth were monstrous.
Her message is that the virus was made in the Wuhan lab. We can definitely hear her out on this, but I cannot find any statement from her saying that the coronavirus was an intentional release.
She said so. If you don’t want to listen to it all, start at the 5 minute mark.

 
No. I do not see us all like Stalin
So you are not capable of seeing other people as evil in some way, of negative value?
She said so. If you don’t want to listen to it all, start at the 5 minute mark.
I was using other sources bc I couldn’t download it earlier. She is going to have a real tough time proving that it was an intentional release. There is no motive. She should have stopped with saying that the lab made it, if she can prove that.
 
Balto1 . . .
Facebook and Instagram get to decide what they allow on their platforms, and have decided not to allow COVID-19 misinformation.
Facebook and Instagram have no idea if this is “COVID-19 misinformation” or not.

They want to stifle the discussion.
 
So you are not capable of seeing other people as evil in some way, of negative value?
There are degrees of evil. Most people are not responsible for the murder of tens of millions of civilians.
I was using other sources bc I couldn’t download it earlier. She is going to have a real tough time proving that it was an intentional release.
I agree, particularly now that she is no longer there and has access to information.
There is no motive.
Oh, there are motives, but she says it well that you have to ask them.
She should have stopped with saying that the lab made it, if she can prove that.
Why is it that she shouldn’t express her views? If she believes it was intentional she has every right to say so.
 
40.png
LeafByNiggle:
Would you care to rephrase that generalization in a more restrictive way?
No…10 characters
And you shouldn’t. The right to speech , by definition, does not include slander. The right to free press does not include libel.
This conflating undermines the right, not the abuse.
 
There are degrees of evil. Most people are not responsible for the murder of tens of millions of civilians.
There are degrees of evil behavior, I agree. But this is my question:
So you are not capable of seeing other people as evil in some way, of negative value?
To label a person or part of oneself or others as evil is hatred. It is a full-stop dismissal of value, seeing a negative value in a person or part of ourselves. Do you have the humility to admit that you are just as capable of the hatred as Stalin?
Oh, there are motives
What is the motive for releasing a virus that will kill many of your own population, even your own elderly relatives indiscriminately? What is the motive for possibly stopping the entire world from receiving products from you own nation in fear of spread of the virus? It makes no sense.

What would you see as the motive for an intentional release, unless it was out of delusional madness on the part of some individual?
Why is it that she shouldn’t express her views? If she believes it was intentional she has every right to say so.
Of course she can express her views, but when she extends her views out of the science and into accusations of intentional release, she loses her credibility. If she can prove with strong evidence that the virus was made in a lab, fine. If she cannot prove that the virus was released intentionally, that not only takes away from her credibility, but it proves that she was making a very serious and slanderous accusation. For Catholics, that is sinful; It is bearing false witness.
 
To label a person or part of oneself or others as evil is hatred.
That’s why I spoke of his actions. Listen, if you want to defend his actions, you’re free to. Hatred is also murdering people to benefit one’s own political power. That’s what he did.
What is the motive for releasing a virus that will kill many of your own population, even your own elderly relatives indiscriminately?
China’s communist regime has an ongoing record of doing so. Ask them, but I suspect it is how they maintain power.
Of course she can express her views, but when she extends her views out of the science and into accusations of intentional release, she loses her credibility
No she doesn’t. She’s made an allegation that says she can prove. We’ll see.
The ones who have lost credibility are those who have tried to silence her.
If she can prove with strong evidence that the virus was made in a lab, fine. If she cannot prove that the virus was released intentionally, that not only takes away from her credibility, but it proves that she was making a very serious and slanderous accusation.
It seems weird that you’re criticizing her but spent the last few quotes minimizing the atrocities of Stalin.
For Catholics, that is sinful; It is bearing false witness.
For all Christians it is. So is the murder of tens of millions of civilians.
 
Last edited:
Hatred is also murdering people to benefit one’s own political power. That’s what he did.
So, are you capable of seeing other people as evil in some way, of negative value, just like Stalin, just like me, just like everyone else?
Listen, if you want to defend his actions, you’re free to.
I have no idea why you think I would want to defend Stalin.
China’s communist regime has an ongoing record of doing so. Ask them, but I suspect it is how they maintain power.
I don’t see how you can make that add up. The regime wants to remain in power, so they release a virus that may end up killing members of the regime, or perhaps their own children or parents. If you are saying that they can easily do this (indiscriminately kill), then welcome to the club! You would be no different in capacity to hate as me, Stalin, and the rest of the human race.

However, the thinking “those people” are capable of such inhumanity (killing their own family) we need to recognize for exactly what it is: hate. And then, it is important to the steps to forgive.
It seems weird that you’re criticizing her but spent the last few quotes minimizing the atrocities of Stalin
This is an untruth. I did not minimize the atrocities of Stalin. I am saying that we are all capable of hate, and we all need to recognize it in ourselves. Saying that the communist regime is capable of indiscriminately killing their own loved ones, just to “remain in power” is hate. This is exactly the sort of thing that Nazis were saying about Jews.
 
So, are you capable of seeing other people as evil in some way, of negative value, just like Stalin, just like me, just like everyone else?
I am capable of seeing people’s actions as evil. His was egregiously so. I have no reason to suspect you fall in that egregious category.
I have no idea why you think I would want to defend Stalin.
You keep going on about him bring like others.
Sorry, but his actions were monstrous.
This is an untruth. I did not minimize the atrocities of Stalin. I am saying that we are all capable of hate, and we all need to recognize it in ourselves.
It sure sounds like it. Do you agree that his actions were far more egregious Than most people? Do you agree that he acted on his evil tendencies?
If so, I think that ends the discussion about him, the comparisons to others.
Saying that the communist regime is capable of indiscriminately killing their own loved ones, just to “remain in power” is hate.
It’s what they have a history of doing. It isn’t hate to point it out. That’s being honest.
This is exactly the sort of thing that Nazis were saying about Jews.
Dishonestly. History shows it’s what they did to the Jews.
 
40.png
OneSheep:
So, are you capable of seeing other people as evil in some way, of negative value, just like Stalin, just like me, just like everyone else?
I am capable of seeing people’s actions as evil. His was egregiously so. I have no reason to suspect you fall in that egregious category.
You are referring to actions, but I am talking about the way we characterize people’s value, their existence, their being as expressed by their God-given nature.

Please try to answer the question again, just considering people’s capacity. It is important to admit that we are all God’s creatures, and all of us have the same nature.
40.png
OneSheep:
I have no idea why you think I would want to defend Stalin.
You keep going on about him bring like others.
Sorry, but his actions were monstrous.
[/quote]

We can definitely agree that his actions were uniquely monstrous. But I’m trying to expose you to a way of looking at people that St. Thomas and other doctors of the Church stated: God created all things good; we all have Christ within us, regardless of the accompanying blindness we may carry. Stalin was blind, just as the crowd was blind. This is not “defending” Stalin’s actions, this is an understanding that leads to forgiveness. We can condemn actions and vehemently defend justice, but do so with forgiving hearts.
40.png
OneSheep:
This is an untruth. I did not minimize the atrocities of Stalin. I am saying that we are all capable of hate, and we all need to recognize it in ourselves.
It sure sounds like it. Do you agree that his actions were far more egregious Than most people? Do you agree that he acted on his evil tendencies?
Yes to both questions. However, now turn the questions around. Do you not, like all of us, have the same “evil tendencies”, yet you do not act on them?
 
40.png
OneSheep:
Saying that the communist regime is capable of indiscriminately killing their own loved ones, just to “remain in power” is hate.
It’s what they have a history of doing. It isn’t hate to point it out. That’s being honest.
Okay, and the Nazis pointed to things some Jews were doing “in history” and at the current time, and were saying that all Jewish people were like that. It’s called prejudice.

Do I think a group of people are animals? Less than human? Guess what, that is exactly the mentality that is crucial in “those animals” ability to do the things that Stalin and other cruel leaders have done. Look in the mirror! Find the post!

The calling of Christ is to seek justice with forgiving hearts.
40.png
OneSheep:
This is exactly the sort of thing that Nazis were saying about Jews.
Dishonestly. History shows it’s what they did to the Jews.
All hate is based on people’s real experiences and even some truth. Jewish people are like everyone else, there are some Jews who do bad stuff and behave unethically in the business world, and these are the cases that the Nazis used as evidence. Prejudice does not spring up out of thin air! Again, I am not defending the Nazis, I am saying that we are all like this, we all have the same capacity, and if I say “those people are capable of indiscriminately killing their own loved ones” this is a manifestation of the same capacity as Nazis or Stalin. It is an attribution of non-human (even non-mammalian!) characteristics to a group of people. When an individual kills someone he loves, he is either out of his mind in anger or insane. That would be an extremely tough case to make for an entire group of people acting in a premeditated way.

It makes no sense for the Chinese government to intentionally release the virus. Accusations of such, without solid proof, are simply false witness.
 
Last edited:
You are referring to actions, but I am talking about the way we characterize people’s value, their existence, their being as expressed by their God-given nature.
That’s fine.
Please try to answer the question again, just considering people’s capacity . It is important to admit that we are all God’s creatures, and all of us have the same nature.
I don’t think anyone has denied that.
Yes to both questions. However, now turn the questions around. Do you not, like all of us, have the same “evil tendencies”, yet you do not act on them?
Concupiscence Is present in all of us.
 
It’s called prejudice.
It’s called racism. The words were untrue. We still hear untrue accusations today about the Jews in reference to the Palestinians.
Do I think a group of people are animals?
Do you? I’ve never made that accusation.
I’ve spoken of actions.
if I say “those people are capable of indiscriminately killing their own loved ones” this is a manifestation of the same capacity as Nazis or Stalin.
No, it isn’t. If it is true that they have killed loved ones in order to maintain power. You added the word “indiscriminate”, not me.
It makes no sense for the Chinese government to intentionally release the virus.
Of course it makes no sense for them to do so. It made no sense for them to kill tens of millions of their own people since 1949.
Accusations of such, without solid proof, are simply false witness.
Those accusations should be investigated, certainly, and not be accepted on face value. But the track record of the communist Chinese government is undeniable, and an investigation is warranted.
 

Dr. Marc Siegel responds to Chinese virologist’s claims about origins of coronavirus​

Sep. 16, 2020 - 2:28 - Fox News medical contributor Dr. Marc Siegel joins Tucker Carlson with reaction on ‘Tucker Carlson Tonight.’
Dr. Marc Siegel responds to Chinese virologist's claims about origins of coronavirus | On Air Videos | Fox News


.

@LeafByNiggle. You do not “peer-review” whistleblower reports (as was suggested here).

And seeing guanine, cytosine, adenine and thymine in differing arrangements cannot disclose to you if the virus naturally mutated or was manipulated and thus mutated in that manner.

It can suggest probabilities but those DNA base pairings (or in this case RNA base order) could be manufactured to suggest a natural mutation too.

We cannot tell the difference between a strand that has base orders of . . .

CGTAGTAGGGCGTTAATGCC

Versus a strand of genetic material that has base orders of . . . .

CGTAGTAGGGCGTTAATGCC

The genetic codes are identical.

Yet one at least theoretically could be manufactured and the other could be a natural mutation.
 
Last edited:
It’s called racism. The words were untrue. We still hear untrue accusations today about the Jews in reference to the Palestinians.
Yes, some of the words spoken about Jews by the Nazis were untrue, but some of them were also true, because people who do evil can be found in any ethnicity or nationality. The same is true for what the Palestinians say about Jewish people, the prejudice is all untruthful, but some of what they base their thinking on is definitely true. Some Jewish people, just like all of us, do bad things, some worse than others.
No, it isn’t. If it is true that they have killed loved ones in order to maintain power. You added the word “indiscriminate”, not me.
Well, you can do the search of this thread, but mine shows that I have consistently used the word “indiscriminate”, and you have not contested the usage. If you are doing so now, then I think we are in agreement, that the Chinese leadership would not release a virus that indiscriminately killed their loved ones.

Since the virus kills indiscriminately, that means you are not saying that the Chinese leadership released it on purpose.
 
Yes, some of the words spoken about Jews by the Nazis were untrue, but some of them were also true, because people who do evil can be found in any ethnicity or nationality.
How about an example.
The same is true for what the Palestinians say about Jewish people, the prejudice is all untruthful, but some of what they base their thinking on is definitely true.
Again, an example. The recent peace agreements between Israel and Arab states shows who holds the overwhelming blame for the plight of Palestinians: Hama and the PA, and their supporters including BDS.
 
@LeafByNiggle. You do not “peer-review” whistleblower reports (as was suggested here).

And seeing guanine, cytosine, adenine and thymine in differing arrangements cannot disclose to you if the virus naturally mutated or was manipulated and thus mutated in that manner.

It can suggest probabilities but those DNA base pairings (or in this case RNA base order) could be manufactured to suggest a natural mutation too.

We cannot tell the difference between a strand that has base orders of . . .

CGTAGTAGGGCGTTAATGCC

Versus a strand of genetic material that has base orders of . . . .

CGTAGTAGGGCGTTAATGCC

The genetic codes are identical.

Yet one at least theoretically could be manufactured and the other could be a natural mutation.
Thank you for your professional opinion on the likelihood of Sars-Cov2 being deliberately engineered. Now can you tell me, in your professional opinion, how one could go about selecting a sequence of C, T, A, a G that will result in a very infectious virus (as opposed to an avocado).
 
Status
Not open for further replies.
Back
Top