@LeafByNiggle. You do not “peer-review” whistleblower reports (as was suggested
here).
And seeing guanine, cytosine, adenine and thymine in differing arrangements cannot disclose to you if the virus naturally mutated or was manipulated and thus mutated in that manner.
It can suggest probabilities but those DNA base pairings (or in this case RNA base order) could be manufactured to suggest a natural mutation too.
We cannot tell the difference between a strand that has base orders of . . .
CGTAGTAGGGCGTTAATGCC
Versus a strand of genetic material that has base orders of . . . .
CGTAGTAGGGCGTTAATGCC
The genetic codes are identical.
Yet one at least theoretically could be manufactured and the other could be a natural mutation.